Labshake search
Citations for Promega :
3951 - 4000 of 4181 citations for 4' Trifluoromethoxy 5 trifluoromethyl 1 1' biphenyl 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Luminescence was measured after 22 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).
-
bioRxiv - Molecular Biology 2024Quote: ... 400 μl cold cell lysis buffer (20 mM HEPES, pH 7.4, 100 mM KCl, 5 mM, MgCl2, 500U/ml RNasin-Plus (Promega), 1x protease inhibitor cocktail (200X ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the equivalent region in the human (−207/+5) were cloned into pGL3-basic Luciferase reporter-vector (E1751, Promega) using the forward primer containing XhoI restriction site ...
-
bioRxiv - Cancer Biology 2024Quote: ... a multiplexed caspase/viability assay was performed as described before [5] using the Multiplex Assay ApoLive-Glo (Promega, G6411) kit.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 5 µL of the supernatant were diluted in 45 µL of Luciferase Assay Reagent (Luciferase Assay System, E1500, Promega) and measured at a Synergy HT reader (BioTek ...
-
bioRxiv - Systems Biology 2023Quote: ... cooled on ice to room temperature for 5 min and digested overnight at 37 °C with 0.5 μg of sequencing-grade trypsin (Promega). Peptide mixtures were acidified to pH 3 with 1.5 µl 5% FA ...
-
bioRxiv - Molecular Biology 2023Quote: ... After incubation at 37 °C/5 % CO2 for 20 h 40 nl HaloTag® NanoBRET™ 618 Ligand (PROMEGA) was added to the cells using an Echo acoustic dispenser (Labcyte ...
-
bioRxiv - Immunology 2023Quote: ... Luminescence was measured after 22 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).
-
bioRxiv - Cancer Biology 2022Quote: ... DNA from My-La cells was amplified by use of primers GATA3_AICE_KpnI s 5’-GCGGTACCATACAGACCCTTCCAGCCAC and GATA3_AICE_XhoI as 5’-GCCTCGAGAACAGATGTGGGGAGTCAGA and cloned via KpnI and XhoI into the multiple cloning site (MCS) of pGL3 (Promega). All constructs were verified by sequencing.
-
bioRxiv - Cell Biology 2023Quote: ... Samples were further diluted with 50 mM Tris pH 7.9 pH 8.0 to a final urea concentration of 2 M and proteins were digested with 5 µg trypsin (Promega) (1/100 ...
-
bioRxiv - Immunology 2023Quote: Promoter constructs were created by cloning the immediate 4.5-kb region adjacent to the 5’ TSS of SPINK7 into the promoterless Nano-luciferase reporter vector pNL1.1-NL (Promega). The 4.5-kb sequence and subsequent constructs were created by using primers with the restriction enzyme sites KpnI-HF and XhoI ...
-
bioRxiv - Cell Biology 2023Quote: ... About 5 µg of the purified mRNA was used to generate cDNA using the Go script kit (Promega #A5001). The KRAS coding region was amplified using a pair of primers Kras_Exon1-F (5’ CCGCCATTTCGGACTGGGAGCGAGCGC 3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... beads were reconstituted in 5 μL 50 mM HEPES pH 8.0 buffer containing trypsin/rLys-C enzyme mix (Promega) at a 1:25 enzyme to protein ratio ...
-
bioRxiv - Biophysics 2024Quote: ... The next day cells were treated with compounds and assessed for cell growth 5 days later using CellTiterGlo (Promega).
-
bioRxiv - Cell Biology 2024Quote: ... 5 regions of ieCTNNB1 and the region containing the mutation site were respectively cloned into pGL3- promoter vector (Promega). HEK293T ...
-
bioRxiv - Biochemistry 2024Quote: ... immune precipitated samples were washed 5 times with lysis buffer and treated with Trypsin Gold (2 μg/ml; Promega) in 20 mM Tris-HCl (pH7.5 ...
-
bioRxiv - Neuroscience 2024Quote: ... Transfection was performed at ∼5 DIV after half-replacing the medium with fresh proliferation medium using Fugene 6 (Promega) with the following ratio ...
-
bioRxiv - Systems Biology 2024Quote: ... Proteins were digested with 5 µL of 100 mM Ambic pH 8.8 that contained ∼250 ng/µL of Trypsin/rLysC enzyme mix (Promega) (Total amount 1.25 µg ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... using primers listed in Supplementary Table 5 and products cloned using the pGEM-T Easy Vector System I (Promega) or Phusion HF DNA polymerase (NEB ...
-
bioRxiv - Physiology 2024Quote: ... Lysates were diluted using one volume of dilution buffer (10 mM Tris pH 8, 0.4% NP40, 5 mM CaCl2, 2 U/mL RQ1 DNAse (Promega)) and then incubated with anti-Flag or anti-p400 antibodies coupled to agarose beads (Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... Protein digestion was carried out in digestion solution (5 ng trypsin/μl in 50 mM ABC, 10% ACN, 0.01% (m/v) ProteaseMAX surfactant (Promega), 1 mM CaCl2 ...
-
bioRxiv - Cell Biology 2024Quote: Column-bound proteins were washed in Binding buffer and then digested with 5 µg of 0.8 µg/µL trypsin solution (Promega) diluted in Digestion buffer (50 mM TEAB at pH 8.5) ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were then co-transfected with either 0.3 μg/well of Smad4 firefly luciferase reporter plasmid constructs (pLuc366 or pLuc207) or the control pGL3-Basic vector (Promega, San Luis Obispo, USA). The renilla luciferase plasmid was also co-transfected to correct for variations in transfection efficiency (45 ng/well) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cells were transfected with 1 μg of DNA (1 μg of an L1-expressing plasmid or 0.5 μg of the L1-expressing plasmid and 0.5 μg of either a pCMV-3Tag-8-Barr control or ISG-expressing plasmid) using 3 µL of FuGENE HD transfection reagent (Promega, Madison, WI, United States) and 100 µL of Opti-MEM (Gibco ...
-
ADEVO: Proof-of-concept of Adenovirus Directed EVOlution by random peptide display on the fiber knobbioRxiv - Bioengineering 2023Quote: ... Media was changed at 3 hpi and luciferase luminescence was measured at 24 hpi using the Nano-Glo® Luciferase Assay (Promega, Madison, USA, #N1130) kit ...
-
bioRxiv - Cell Biology 2024Quote: ... The resulting pellets were resuspended in digestion buffer (1 M Guanidinium Chloride in 100 mM HEPES pH 8.0) and digested by consecutive addition of LysC (3 h at 37°C) and trypsin (Promega, 16 h at 37°C). The obtained digested peptides were acidified and desalted using a Waters Oasis HLB μElution Plate 30 μm (Waters ...
-
bioRxiv - Neuroscience 2020Quote: ... the RNA-bound beads were washed four times in 900 μL of 0.35 M KCl (10 mM HEPES [pH 7.4], 350 mM KCl, 10 mM MgCl2, 1% NP40, 2 mM DTT, 100 U/mL RNasin® Ribonuclease Inhibitors [Promega, N2111], and 100 μg/mL cycloheximide). During the final wash ...
-
bioRxiv - Cell Biology 2021Quote: ... 30 min at 60°C) an alkylation (IAA 0.5M, 30 min RT) microtubule-associated protein enriched fractions were digested using trypsin (Gold, Promega, 1 μg / sample, overnight at 30°C). Peptide clean-up was done using OMIX C18 (Agilent ...
-
bioRxiv - Neuroscience 2020Quote: ... the RNA-bound beads were washed four times in 900μL of 0.35M KCl (10mM HEPES [pH 7.4], 350 mM KCl, 10 mM MgCl2, 1% NP40, 2 mM DTT, 100 U/mL RNasin® Ribonuclease Inhibitors [Promega, N2111], and 100 μg/mL cycloheximide). During the final wash ...
-
bioRxiv - Neuroscience 2020Quote: ... the RNA-bound beads were washed four times in 900μL of 0.35M KCl (10mM HEPES [pH 7.4], 350 mM KCl, 10 mM MgCl2, 1% NP40, 2 mM DTT, 100 U/mL RNasin® Ribonuclease Inhibitors [Promega, N2111], and 100 μg/mL cycloheximide). During the final wash ...
-
bioRxiv - Microbiology 2020Quote: ... alkylation was performed using 20 mM 2-chloroacetamide at room temperature in HEPES buffer for 30 min under exclusion of light. Samples were prepared according to the SP3 protocol (Hughes et al. 2019) and trypsinized (sequencing grade, Promega, enzyme to protein ratio 1:50) overnight at 37°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... The membranes were washed 3x 10 minutes in TBS-T before being incubated for 2 hours with the secondary anti-mouse-HRP- or anti-rabbit HRP antibody (1:5000, Promega anti-mouse, W4021; anti-rabbit W4011). The membranes were washed in TBS-T for 3x 10 minutes and developed with Western Lightning Plus-ECL reagent (Perkin Elmer NEL104) ...
-
bioRxiv - Microbiology 2022Quote: ... the virus-induced cytopathogenic effect was measured colorimetrically by the formazan-based 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) cell viability assay (CellTiter 96 AQueous One Solution Cell Proliferation Assay from Promega, Madison, WI), and the antiviral activity was expressed as the 50% effective concentration (EC50) ...
-
bioRxiv - Genomics 2022Quote: The 293T cells in 96-well plates were transiently transfected with 200 ng Firefly luciferase vector (pGL3) and 4 ng pRL-TK Renilla luciferase vector (Promega, Madison, USA) using 0.5 uL Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2021Quote: ... 30 μg of protein was digested with Lys-C (FUJIFILM Wako Chemicals Europe GmbH, Germany) for 4 h and subsequently with modified porcine trypsin (Promega, WI, USA) for 16 h at 37 °C.
-
bioRxiv - Plant Biology 2020Quote: ... The columns were capped at the bottom and 200 µl AmBic containing 4 ng/µl of Trypsin + LysC (Promega Catalog number V5073) was added to each sample and incubated in a 37°C shaker for 16 hours ...
-
bioRxiv - Molecular Biology 2022Quote: ... Pelleted cells were disrupted by glass beads agitation at 4°C in 1x Passive Lysis Buffer provided in the Dual-Luciferase® Reporter Assay System (Promega, #E1910). Extracts were clarified by centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... The clear supernatant was incubated overnight at 4°C with 100 μl of prewashed Magne® HaloTag® Beads (Promega, WI, USA). Post-incubation ...
-
bioRxiv - Genomics 2023Quote: ... Primers bearing kpnI and BgLII sites (Additional Table 4) allowed incorporation into pGL3-Basic reporter vector containing luciferase gene from the firefly Photinus pyralis (Promega, Wisconsin, USA). Amplification was carried out using Phusion HotStart II Polymerase ...
-
bioRxiv - Immunology 2023Quote: ... 4 µl of cDNA per sample were used and qRT-PCR was performed using the GoTaq® qPCR Master Mix (Promega, #A6001) on a LightCycler 96 (Roche) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Luminescence was measured 24 h after plating (T0) and after 4 d using the CellTiter-Glo Luminescent Cell Viability Assay protocol (Promega; cat# G7573). When indicated ...
-
bioRxiv - Genetics 2023Quote: ... 3,500,000 cells were seeded in 10 cm plates (2-4 per replicate) and transfected with FuGENE® 6 Transfection Reagent (Promega, E2692). In one tube ...
-
bioRxiv - Microbiology 2024Quote: ... Cells infected with viruses expressing luciferase were harvested 4 days after infection and analyzed for luciferase activity with a luminescence kit (Bright-Glo™ Luciferase Assay System, Promega, E2620) as described in (61).
-
bioRxiv - Neuroscience 2021Quote: ... Blots were washed 3 times in TBST for 5 minutes and further incubated with HRP-conjugated secondary anti-mouse-IgG-H&L chain (Promega) or anti-rabbit-IgG-F(ab’)2 (GE Healthcare ...
-
bioRxiv - Neuroscience 2021Quote: IP and pull-down probes of DG NSCs were subjected to on-bead digestion (Hubner et al., 2010) by trypsin (5 µg/ml, Promega) in 1.6 M Urea / 0.1 M Ammonium bicarbonate buffer at 27 C for 30 minutes ...
-
bioRxiv - Genomics 2020Quote: ... 500 cells were plated in each well of 96-well-plate and each sample had 6 replicates and monitored for 6 days from day 0 to day 5 by CellTiter-Glo 2.0 Assay (Promega, G9242) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... 40% confluent HAP 1 WT cells (seeded in a 10-cm dish) were co-transfected with the two plasmids described above (5 µg each) using 30 µl Fugene6 transfection reagent (Promega) in OptiMEM medium ...
-
bioRxiv - Cell Biology 2020Quote: ... Remaining iodoacetamide was quenched by adding 5 mM DTT and the proteins were digested with 150 ng trypsin (Trypsin Gold, Promega) at room temperature for 90 min ...
-
bioRxiv - Bioengineering 2021Quote: ... Ligations of the digested plasmid backbones and PCR products occurred for 5-10 minutes at RT using T4 DNA ligase (Promega) prior to transformation into NEB® Turbo Competent E ...
-
bioRxiv - Biochemistry 2021Quote: The samples were reduced and digested in 25 μL co-IP digest buffer (50 mM Tris-HCl, 5 ng/μL trypsin (sequencing grade, modified, Promega), 2 M urea ...