Labshake search
Citations for Promega :
351 - 400 of 1997 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... with upstream primer UG5953 and downstream primers YA9566 (100 bp) or YA9567 (200 bp) and ligated into pGEM-Teasy (Promega) to create pCB4633 and pCB4634 ...
-
bioRxiv - Genomics 2022Quote: ... The pRF+423Dux 4 vector was sequenced using primers that anneal to the pGL3 vector (Promega, see primers Table S2). The Dux4 IRES site was deleted from pRF+423Dux4 using PCR primers that flank the IRES region (PRF423DUX4-ATW F and R ...
-
bioRxiv - Physiology 2022Quote: ... gDNA was purified using Purelink spin columns and PCR amplified with specific primers (see Supplementary Table S2 for primer sequences and annealing temperatures) using GoTaq Hot Start Polymerase (Promega). PCR conditions were 95°C for 3 min ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA of BdNRT2A was first amplified by PCR using specific forward primer 70F2 and reverse primer 70R2 before being cloned into the pGEMT-easy vector (Promega). Clones with correct sequence were used to produced appropriate PCR product for Gateway cloning ...
-
bioRxiv - Cell Biology 2020Quote: ... random primers (10 ng/μl, Promega, Wisconsin, USA) and dNTPs (0,5 mM ...
-
bioRxiv - Neuroscience 2020Quote: ... with Random Primers (Promega, Madison, Wisconsin, USA, C1181).
-
Interdependent Iron and Phosphorus Availability Controls Photosynthesis Through Retrograde SignalingbioRxiv - Plant Biology 2021Quote: ... to synthesize cDNA using oligo(dT) primer (Promega). Real-time quantitative reverse-transcription PCR (qRT-PCR ...
-
bioRxiv - Genetics 2022Quote: ... RNAs were annealed with Random Primers (Promega, C118A) and RT was performed with the RevertAid H Minus Reverse Transcriptase (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Oligo(dT)15 primers (Promega, United States) according to the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA synthesis was performed using random primers (Promega) and M-MLV reverse transcriptase (Promega) ...
-
bioRxiv - Developmental Biology 2021Quote: ... plus 2 uL of random primers (Promega, C1181). This was then incubated at 70 °C for 10 mins ...
-
bioRxiv - Immunology 2020Quote: ... and converted into cDNA using random primers (Promega) and M-MLV RT RNAse (H- ...
-
bioRxiv - Cell Biology 2024Quote: ... was used with random primers (Promega, Charbonniéres, France) to synthesize cDNA from 1μg of total RNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... with random primers (Promega, Charbonnières-les-bains, France).
-
bioRxiv - Immunology 2023Quote: ... dNTP Mix and Oligo (dT)15 Primer (Promega), Low Input Quick Amp Labeling Kit ...
-
bioRxiv - Immunology 2024Quote: ... and oligo(dT)15 primer (all from Promega). Using cDNAs as templates ...
-
bioRxiv - Plant Biology 2020Quote: The qRT-PCRs/qPCR reactions were set up using the GoTaq® qPCR Mastermix (Promega, Madison, Wisconsin, USA) according to the manufacturer’s instructions in a total volume of 15 μl ...
-
bioRxiv - Plant Biology 2021Quote: The SCYLV titer in each sample was determined by qPCR using GoTaq qPCR Master Mix (Promega, Madison, USA) on a Bio-Rad CFX384 Touch detection system (Bio-Rad ...
-
bioRxiv - Neuroscience 2020Quote: ... RT-qPCR was performed on the ViiA 7 Real-Time PCR System using GoTaq qPCR master mix (Promega) according to the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was diluted 1:5 before quantitative analysis by qPCR was done using GoTaq qPCR Master Mix (Promega) following manufacturer’s recommendations ...
-
bioRxiv - Physiology 2021Quote: ... The resultant cDNA was assessed by RT-qPCR using SYBR® Green Supermix 2x qPCR master mix (Promega) in a ABI PRISM 7900HT Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Quantitative real time PCR (qPCR) from 10ng of gDNA was performed using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Physiology 2024Quote: ... The resulting cDNA was analyzed by RT-qPCR using SYBR green fluorescent dye 2x qPCR master mix (Promega) in a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems) ...
-
Identification of echinacoside as a tobramycin potentiator against Pseudomonas aeruginosa aggregatesbioRxiv - Microbiology 2024Quote: ... Such cDNA samples were applied as templates for RT-qPCR using 2× GoTaq® qPCR Master Mix (Promega). The reactions were performed on the CFX96TM system (BIO-RAD ...
-
bioRxiv - Cell Biology 2023Quote: ... The resulting cDNA was analyzed by RT-qPCR using SYBR green fluorescent dye 2x qPCR master mix (Promega) in a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the housekeeper gene Hprt (ID: Mm03024075_m1) using GoTaq Probe qPCR and RT-qPCR System (Promega, Madison, WI) and Quantstudio 7 flex RT-PCR system (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... AePer50 reverse transcription (RT) and qPCR reactions were performed using GoTaq® 1-Step RT-qPCR System (Promega), with 10 µl of 2X qPCR Master Mix ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA synthesis and qPCR were performed using the GoTaq 2-step RT-qPCR system (Promega, Madison, MA, USA) with an ABI Prism 7900HT Sequence Detection System (Applied Biosystems ...
-
Development of a genetically encoded sensor for probing endogenous nociceptin opioid peptide releasebioRxiv - Neuroscience 2024Quote: HEK293 cells growing at 70% confluency in a 10-cm dish were transfected with wild-type human NOPR or NOPLight (3 μg DNA) and GloSensor-20F (Promega, 2.5 μg DNA) using 12 μL Lipofectamine 2000 (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2020Quote: ... qPCR was performed using SYBR Green (Promega) and run on a C1000 Touch™ thermal cycler (Bio-Rad) ...
-
bioRxiv - Plant Biology 2021Quote: ... with GoTaq qPCR mix (Promega, Madison, USA). The primers designed in this study were listed in Table ...
-
bioRxiv - Microbiology 2020Quote: ... GoTaq 1-Step RT-qPCR kit (Promega) was used at a final volume of 20 μl with ...
-
bioRxiv - Plant Biology 2021Quote: ... A One-step RT-qPCR kit (Promega) was used for converting the RNA into cDNA before amplifying target transcripts on a CFX Connect Real-Time PCR Detection System (Biorad) ...
-
bioRxiv - Pathology 2020Quote: ... using GoTaq 1-Step RT-qPCR (Promega) with the SARS-CoV-2 CDC N3 primers (F – GGGAGCCTTGAATACACCAAAA ...
-
bioRxiv - Cancer Biology 2020Quote: ... and GoTaq Probe qPCR Master Mix (Promega) according to manufacturers’ protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... The GoTaq® qPCR Master Mix (Promega) was used according to manufacturer’s instructions and the samples were run in triplicate on the AriaMx Real-time PCR System (Agilent) ...
-
bioRxiv - Cancer Biology 2022Quote: ... GoTaq qPCR Master Mix kit (Promega #A6001) and specific primers were used to set up the quantitative real-time PCR (qPCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... and GoTaq® qPCR Master Mix (Promega). Two references were used for normalization and the fold induction of mRNA of the target of interest was calculated compared to the control sample using the ΔΔCq method ...
-
bioRxiv - Microbiology 2023Quote: ... using GoTaq® qPCR Master Mix (Promega). Analyses were performed following the manufactureŕs protocol using gene-specific qPCR primers ...
-
bioRxiv - Microbiology 2023Quote: ... and 2× GoTaq qPCR Master Mix (Promega). qPCR was performed using the MyGo Pro real-time PCR instrument (IT-IS Life Science Ltd.) ...
-
bioRxiv - Systems Biology 2024Quote: ... 12.5 μl GoTaq qPCR Master Mix (Promega), 9.3 μl nuclease-free H2O and 1 μl of each of the corresponding sense and antisense primers (10 pmol/μl) ...
-
bioRxiv - Developmental Biology 2024Quote: ... GoTaq qPCR master mix (Promega, Wisconsin, USA) and qTOWER3 G (Analytik Jena ...
-
bioRxiv - Microbiology 2024Quote: ... The express GoTaq® RT-qPCR (Promega) was used with 10 μL of GoTaq® qPCR Master Mix ...
-
bioRxiv - Plant Biology 2024Quote: ... using the GoTaq qPCR Mastermix (Promega, USA). Per reaction ...
-
bioRxiv - Bioengineering 2024Quote: ... using qPCR SYBR Master Mix (Promega; A6001) to detect SYBR Green 1 ...
-
bioRxiv - Genomics 2020Quote: ... TRs were amplified using the forward and reverse primers plus an M13 primer with one of the four fluorophores with GoTaq polymerase (Promega #PRM7123) using PCR program ...
-
bioRxiv - Genomics 2023Quote: ... TRs were amplified using the forward and reverse primers plus an M13 primer with one of the four fluorophores with GoTaq polymerase (Promega #PRM7123) using PCR program ...
-
bioRxiv - Cell Biology 2022Quote: ... After 3 days Caspase-Glo 3/7 (Promega) and CellTiterGlo (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was diluted either 1:5 or 1:10 for all qPCR experiments and GoTaq qPCR Master Mix (Promega) was used to amplify cDNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... qPCR was performed on a Bio-Rad CFX96 Real-Time PCR system with the GoTaq qPCR Master Mix (Promega). Relative gene expression levels were calculated using the ΔΔCt method with CPA as the reference gene.