Labshake search
Citations for Promega :
501 - 550 of 1997 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... using the GoTaq® qPCR Master Mix kit (Promega) in 384-well plates ...
-
bioRxiv - Neuroscience 2024Quote: ... Amplification of genes utilized GoTaq qPCR Master Mix (Promega) as per the manufacturer’s protocol on the LightCycler® II 480 system machine (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... using SYBR qPCR master mix (Promega, Cat No. #4367659). All values were obtained in triplicate ...
-
bioRxiv - Molecular Biology 2022Quote: ... or by qPCR (ProNex NGS Library Quant Kit, Promega). DNA libraries were sequenced on Illumina NextSeq 500 or Illumina MiSeq platforms.
-
bioRxiv - Plant Biology 2023Quote: ... the 2x GoTaq qPCR Master Mix (Promega, Mannheim, Germany) was used ...
-
bioRxiv - Microbiology 2023Quote: ... using SYBR Green GoTaq 1-Step RT-qPCR (Promega) with the SARS-CoV-2 CDC N3 primers (F – GGGAGCCTTGAATACACCAAAA ...
-
bioRxiv - Biochemistry 2021Quote: DNA constructs were transcribed and translated in vitro in pairs using equimolar plasmids in 70 μL of TNT® Quick Coupled Transcription/Translation System (Promega). RNaseOUT (0.5 ΜL ...
-
bioRxiv - Systems Biology 2020Quote: ... Human cell lysate (MS Compatible Human Protein Extract, Digest, V6951) were purchased from Promega.
-
bioRxiv - Neuroscience 2020Quote: ... All designed probes were tested by ddPCR using human genomic DNA (Human male, Promega) as a negative control ...
-
bioRxiv - Plant Biology 2023Quote: ... The selected interactions were verified by quantitative β-galactosidase assays using Beta-Glo Assay System (Promega, Madison, WI, USA). Briefly ...
-
bioRxiv - Cancer Biology 2024Quote: ... qPCR amplification and analysis were conducted using the 7500HT Real-Time PCR System (ABiosystems) using GoTaq® qPCR Master Mix (Promega, Ref A6002). RNA levels were normalized to HPRT expression using the DDCt method ...
-
bioRxiv - Molecular Biology 2022Quote: ... Human Genomic DNA (G1521, Promega) was used as positive control and synthetic DNA was used to validate the LAMP assay performance ...
-
bioRxiv - Genomics 2020Quote: Total RNA was reverse transcribed to cDNA using random primers (Promega) and M-MLV Reverse Transcriptase RNase H (Promega) ...
-
bioRxiv - Neuroscience 2021Quote: ... and reverse transcribed with GoScript Reverse Transcriptase with random primers (Promega). Real-time quantitative PCR was done using FAM-MGB-labeled Col6a3 (Mm00711678_m1 ...
-
bioRxiv - Plant Biology 2020Quote: ... using M-MLV reverse transcriptase and oligo(dT)15 primer (Promega). Two ng of cDNA was used as template in qPCRs ...
-
bioRxiv - Bioengineering 2020Quote: ... with specific primers (Suppl. Table 1) from pNL1.1 (Promega, Fitchburg, WI) and inserted between the SalI and BglII sites using NEBuilder HiFi DNA Assembly Master Mix ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was transcribed into cDNA using an oligo dTn primer (Promega) per reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was transcribed into cDNA using an oligo dTn primer (Promega) per reaction ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... an anchor-oligo(dT) primer (Table S1) and random hexamers (Promega). The reverse anchor and forward nested degenerated PGM primers derived from the oyster Crassostrea gigas and human Pgm-1 sequences were then used to perform the upstream amplification of cDNA fragments (see Table S1) ...
-
bioRxiv - Plant Biology 2024Quote: ... according to the instructions: stock oligo(dT)15 primer (C1101, Promega) concentration was 100 ng/μl ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10X Primer extension buffer and 2 U AMV Reverse Transcriptase (Promega) were added to the annealing mixture and incubated for 1 hour at 42 °C ...
-
bioRxiv - Immunology 2023Quote: ... 100 nM probe and 150 ng random primers (Promega, Madison, WI). Reactions cycled with the following conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL of 100 ng/µL random hexamer primers (Promega: C1181) was added to each sample ...
-
bioRxiv - Plant Biology 2023Quote: ... oligo(dT) primer and reverse transcriptase ImProm-II (Promega, https://www.promega.com). Three biological replicates for each type of sample were used for sequencing ...
-
bioRxiv - Plant Biology 2023Quote: ... oligo(dT) 18 primers and the GoScript™ Reverse Transcriptase (Promega). qRT-PCR was performed using gene-specific primers (Supplementary Table 1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 100 nM dT-primer and 4 U RNase Inhibitor (Promega, N2611). Reverse transcription was performed at 42°C for 90 min after filling up to 10 μl with RT buffer mix for a final concentration of 1x superscript II buffer (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... Total RNA (500 ng) was reverse transcribed using random primers (Promega) and AMV Reverse Transcriptase (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... the RNasin Plus RNase inhibitor and random primers (all from Promega). SYBR Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2024Quote: ... with random primers and the M-MLV reverse transcription system (Promega). Quantitative PCR was then conducted using SYBRgreen I technology with ORA qPCR Green ROX L Mix (HighQu ...
-
bioRxiv - Molecular Biology 2021Quote: ... the two blots were hybridized O/N at 65 °C to each their radioactively labeled 3’ CF probe (AGO1 3’ CF and CSD2 3’ CF probes labelled with Prime-a-gene labeling kit from Promega). The membranes were washed 3 times in 2xSSC (0.3 M NaCl ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase-Glo 3/7 Reagent (Caspase-Glo® 3/7 Assay, Promega) was added to the wells ...
-
bioRxiv - Cancer Biology 2022Quote: ... Caspase 3/7 activity was detected using Caspase-Glo 3/7 (Promega). Annexin V/Propidium Iodide staining was performed using Alexa Fluor 488 Annexin V/Dead Cell Apoptosis Kit (Invitrogen) ...
-
bioRxiv - Neuroscience 2021Quote: ... caspase-3/7 levels were examined using Caspase-Glo 3/7 (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... the presence of other main circulating arboviruses was evaluated by RT-qPCR using GoTaq® 1-Step RT-qPCR System (Promega, Madison, WI, USA). Specific diagnosis primers were used for Zika [30] ...
-
ITPK1 is an InsP6/ADP phosphotransferase that controls systemic phosphate homeostasis in ArabidopsisbioRxiv - Plant Biology 2020Quote: ... and the Go Taq qPCR Master Mix SybrGreen I (Promega) using the primers listed in Supplementary Table 1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 μL of GoTaq® Probe qPCR Master Mix (Promega) and 0.5 μL of the appropriate TaqMan Assay (20X ...
-
bioRxiv - Neuroscience 2020Quote: ... using the GoTaq® 2-step RT-qPCR kit (Promega). Quantitative PCR runs were performed on a 7900HT Fast Real-Time PCR System (Applied Biosystems Inc. ...
-
bioRxiv - Molecular Biology 2020Quote: ... using GoTaq qPCR Master Mix (Promega Co., Madison, WI, USA). Primers used in this study were as follows:
-
bioRxiv - Neuroscience 2022Quote: ... using GoTaq® Probe 1-Step RT-qPCR System (Promega). The CDC SARS-CoV-2 nucleoprotein N2 primer set was used for amplification ...
-
bioRxiv - Developmental Biology 2022Quote: ... using GoTaq qPCR Master Mix (Promega, Madison, WI, Cat #A6001).
-
bioRxiv - Neuroscience 2020Quote: ... qRT-PCR was performed using GoTaq qPCR Master Mix (Promega) according to the recommended protocol ...
-
bioRxiv - Microbiology 2022Quote: ... using the GoTaq 1-Step RT-qPCR System (Promega, USA) and primers targeting the gene coding for the endogenous control β-actin ...
-
bioRxiv - Cancer Biology 2020Quote: ... The qRT-PCR was performed with GoTac® qPCR (Promega) with 10 ng cDNA template on a Biorad CFX384 Real Time Cycler ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Quantitative real-time PCR was performed using GoTaq qPCR (Promega) BRYT Green Dye-based detection and CFAV NS3-specific primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... Diluted cDNAs were mixed with GoTaq qPCR Master Mix (Promega) and analysed with Piko-Real 96 Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2024Quote: ... using GoTaq® qPCR Master MixA6001 (Promega, Madison, WI, USA) with the following protocol ...
-
bioRxiv - Immunology 2024Quote: ... qRT- PCR was performed using GoTaq qPCR master mix (Promega) and primers specific for LRBA (forward ...
-
Analysis of spike protein variants evolved in a novel mouse model of persistent SARS-CoV-2 infectionbioRxiv - Microbiology 2023Quote: ... 10 µL of GoTaq Probe qPCR Master Mix (Promega, A6101) was added to 10 µL of the reaction mixture containing 125 nM each of the forward and reverse primers ...
-
bioRxiv - Cell Biology 2023Quote: ... using GoTaq® qPCR Master Mix (Promega Cat. No. A6001) following ‘manufacturer’s instructions on a Veriti Thermo Cycler (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA were amplified with the GoTaq qPCR Master Mix (Promega) and the fluorescence was measure on a QuantStudio 6 Flex System (Applied Biosystems) ...