Labshake search
Citations for Promega :
301 - 350 of 1703 citations for pIEXBac c EGFP 3 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 assay reagents (Promega, WI, USA) were added to each well according to the manufacturer’s instructions (ratio of 1:4) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3’-UTR derived from pNL1.1[Nluc] vector (Promega), and 50 nt poly(A ...
-
bioRxiv - Immunology 2021Quote: ... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
bioRxiv - Bioengineering 2021Quote: ... Caspase-Glo® 3/7 Assay System (Promega) was used according to manufacturer’s guidelines ...
-
bioRxiv - Systems Biology 2020Quote: ... and T4 DNA ligase (3 U/μί, Promega) were applied to assemble all of the synthetic promoter blocks sequentially and simultaneously into the firefly reporter vector backbone in a one-pot reaction ...
-
bioRxiv - Cancer Biology 2020Quote: Caspase 3/7 Assay kit (Promega, Southampton, UK) was utilized to assess apoptosis as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Caspase-Glo 3/7 assay (Promega, Madison, WI) (5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Caspase-Glo 3/7 Assay (Promega, Cat# G8090) reagent was added to the cells and incubated for 30 min ...
-
bioRxiv - Bioengineering 2022Quote: ... by Caspase-Glo® 3/7 Assay (Promega) using GloMax Discover Microplate Reader (Promega).
-
bioRxiv - Biochemistry 2021Quote: ... 1.8 nM 3 kb supercoiled pGEMT plasmid (Promega), and 20 nM MMTV intasomes in a final volume of 15 µL ...
-
bioRxiv - Cancer Biology 2022Quote: ... or Caspase-Glo® 3/7 (Promega, USA) respectively ...
-
bioRxiv - Cancer Biology 2024Quote: ... Caspase-Glo 3/7 3D Assay (Promega, #G8981) was added and the mixture incubated per manufacturer instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... The caspase 3/7 (Caspase-GloTM Promega G8090) level was measured per the manufacturer’s instructions.
-
bioRxiv - Zoology 2023Quote: ... and 3% 20 mg/ml Proteinase K (Promega). This digestion eliminates cellular material while leaving the spongin network intact ...
-
bioRxiv - Cell Biology 2023Quote: Caspase-Glo 3/7 Assay (Promega, Fitchburg, WI) and ROS-Glo H2O2 Assay (Promega ...
-
bioRxiv - Zoology 2024Quote: ... and 3% 20 mg/ml Proteinase K (Promega). This method removed cellular material while preserving spicules and the spongin network (if present) ...
-
bioRxiv - Biochemistry 2021Quote: ... The residual magnetic beads were then incubated for two hours at 4°C and for one hour at 16°C in 83 microlitres of buffer A200 with 20 Units RNasin (Promega), 12mM DTT and 16 micrograms of TEV-Protease ...
-
bioRxiv - Bioengineering 2022Quote: ... Proteins were digested using Lys-C (Wako, 1:40, w/w, overnight under gentle shaking at 30°C) and modified trypsin (Promega, 1:60 ...
-
bioRxiv - Cell Biology 2022Quote: ... two micrograms of RNA from each sample were reverse transcribed at 42 °C for 1 h followed by 95 °C for 10 min M-MLV Reverse Transcriptase (Promega) and oligo(T)18 primers (Takara) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The proteins were diluted 1:5 with 100 mM ammonium bicarbonate and digested overnight at 37°C following the addition of 1 µg of Trypsin/Lys-C protease mixture (Promega) and calcium chloride to a concentration of 1 mM ...
-
bioRxiv - Systems Biology 2020Quote: ... pH 8.0 and digested for 16 hours on a shaker at 37 °C with a 1:40 ratio of Trypsin/Lys-C mix (Promega). Each sample was de-salted using HLB plates (Oasis HLB 30μm ...
-
bioRxiv - Genomics 2022Quote: ... samples were diluted 3 times with 50mM Tris buffer (down to 2M final urea concentration) and digested overnight at 37°C using a Trypsin/Lys-C mixture (Promega) at a ratio 1:100 w/w ...
-
bioRxiv - Microbiology 2020Quote: ... All samples were digested overnight at 37 °C using a Trypsin/Lys-C Mix (mass spec grade, Promega, Madison, WI) (enzyme/substrate of 1:100 w/w ...
-
bioRxiv - Cell Biology 2021Quote: ... Eluted proteins from control HeLa cells with C-terminal mEGFP tag were digested with mass-spectrometry grade Lys-C and trypsin (Promega). Eluted proteins from a cell line lacking full-length Cdc20 (CDC20_M1-fs-M43 ...
-
bioRxiv - Cell Biology 2021Quote: ... 50°C for 60 min and 70°C for 15 min) in the presence of 10 fg of Luciferase RNA (Promega) using the SuperSript III reverse transcription kit (Invitrogen) ...
-
bioRxiv - Neuroscience 2024Quote: ... the bead and protein mixtures were washed twice with 80% ethyl alcohol and once with 100% ACN before being resuspended in 95 µL NH4HCO3 prior to overnight on-bead digestion (enzyme–protein ratio of 1:20) at 1 000 rpm at 37 °C using modified porcine trypsin/Lys-C Mix (Mass Spectrometry Grade, Promega). The digestion was stopped using trifluoroacetic acid (TFA ...
-
bioRxiv - Immunology 2023Quote: ... samples were diluted 1:1 with water and digested for 1.5 hours at 37 °C with 1 µg of LysC and overnight at 37 °C with 1 µg trypsin (Promega). The peptide mixture was acidified with trifluoroacetic acid (Merck ...
-
bioRxiv - Cancer Biology 2023Quote: ... 58 °C for 45 seconds and 72 °C for 1 minute (32 cycles) and 72 °C for 10 minutes (1 cycle) using GoTaq G2 DNA polymerase (Promega). Additionally ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein was then digested with 2.5 μg Lys-C (Wako, Japan) for 4 h at 37°C and 2 μg trypsin (Promega, V5113) for an additional 4 h at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... Mtb samples were inactivated at >95°C for 20 min and stored at -20°C until analyzing the ATP levels using the BacTiter Glo assay (Promega) as previously described (19) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 56 °C for 30 seconds and 72 °C for 30 seconds (30 cycles) and 72 °C for 5 minutes using GoTaq DNA polymerase (Promega) and a forward primer (hChimera exon 1-F ...
-
bioRxiv - Developmental Biology 2023Quote: ... The modified proteins were digested with lysyl endopeptidase (Lys-C) (Wako) for 3h at 37° C and subsequently digested with trypsin (Promega) overnight at 37° C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... in which proteins were reduced (DTT) and alkylated (IAA) before the digestion with Trypsin and Lys-C (Trypsin/Lys-C Mix, Mass Spec Grade Promega) for 14 hours at 37° C ...
-
bioRxiv - Cell Biology 2024Quote: ... pH 8.5 to a final urea concentration of 2 M for Trypsin/Lys-C based overnight protein digestion at 37 °C (0.5 µg protease, Mass Spectrometry grade, Promega V5072). Peptide Purification and Labeling ...
-
bioRxiv - Cell Biology 2024Quote: ... with the following modification: Digestion was performed at 37°C overnight using 400 ng of Trypsin/Lys-C mix (Promega) in a buffer of 50 mM ammonium bicarbonate with 0.01% ProteaseMax surfactant added (Promega) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The endpoints of the second screen were caspase 3/7 activity measured using the CaspaseGlo® 3/7 assay reagent (Promega) at the 8-hour and 16-hour time intervals ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... DDX60 (Fw 5’- AAGGTGTTCCTTGATGATCTCC-3’ Rv : 5’ -TGACAATGGGAGTTGATATTCC-3’) as analyzed by semiquantitative PCR using the SYBR Green assay GoTaq® qPCR Master Mix (Promega) with standardized primers (Metabion) ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Neuroscience 2023Quote: ... 10 µL of 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) reagent (#G3582; Promega, Madison, WI) was added and incubated at 37°C for 45 mins ...
-
bioRxiv - Cell Biology 2024Quote: ... Apoptosis was determined as Caspase-3/7 activity immediately after 6-day culture using Caspase-Glo 3/7 Assay (Promega, USA). Luminescence was recorded with the Infinite M200 PRO microplate reader (Tecan ...
-
bioRxiv - Cancer Biology 2024Quote: ZEB1 3′UTR region with mitomiR-3 binding site was cloned into pmirGLO-Dual Luciferase miRNA target expression vector (Promega, USA) for miRNA luciferase reporter assay (Promega ...
-
bioRxiv - Biochemistry 2020Quote: ... and then digested with trypsin/Lys-C (Promega) for 16 h at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... alkylated and digested with endoproteinase Lys-C (Promega) followed by modified trypsin (Promega ...