Labshake search
Citations for Promega :
3151 - 3200 of 3490 citations for 8 Chloro 2 chloromethyl imidazo 1 2 a pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Alkylated proteins were then cleaved using a two-step digestion: first with Endoproteinase Lys-C (ratio 1:33 enzyme: lysate, Promega) for 1 hour at 37 °C then with Trypsin (ratio 1:33 enzyme ...
-
bioRxiv - Biochemistry 2024Quote: ... at a 1:75 enzyme to protein ratio for 6 h at 30 °C and then by trypsin (V5111, Promega) (1:50 enzyme to protein ratio ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Denatured proteins were enzymatically digested for 14 h at 37 °C with 1 µg of sequencing-grade Trypsin (V511A, Promega). After speed-vaccum drying ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was digested overnight at 37 °C with sequencing-grade trypsin or chymotrypsin (Promega; 1:100 protease:protein weight ratio). After desalting on a C18 column (Pierce ...
-
bioRxiv - Neuroscience 2023Quote: ... We performed targeted PCR by adding 1 μL of cell lysate (1:5 dilution) to a 25-μL PCR reaction containing GoTaq Hot Start Master Mix Green (Promega) and 0.5 μL of the primers (10 µM ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ObLiGaRe-TLR construct was co-transfected with Zinc Finger Nuclease (ZFN)-AAVS1 plasmid in a 1:3 ratio using FuGENE transfection reagent (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Protein mixtures were diluted in 1:6 ratio (v/v) using ultrapure water prior to digestion using sequencing grade trypsin (Promega) at 37°C for 16 h ...
-
bioRxiv - Immunology 2023Quote: ... Cells were washed once with PBS and lysed for at least 1 h with 40 μl 1x passive lysis buffer (Promega) at RT ...
-
bioRxiv - Microbiology 2022Quote: RT-qPCR analyses of NoV GII were carried out using GoTaq® Probe 1-Step RT-qPCR System (Promega, USA). Primers and the FAM/TAMRA-labelled probe of hNoV GII were according to ISO 15216-1:2017 ...
-
bioRxiv - Microbiology 2023Quote: ... 100 μL of these purified Se cells or 100 μL of the corresponding Se-Ai cocultures were mixed with 100 μL Nano-Glo Luciferase assay reagent (50:1 mixture of substrate:buffer, Promega N1110) in a 96-well plate ...
-
bioRxiv - Microbiology 2023Quote: ... Membranes were washed in 1×PBST and then incubated with the secondary antibody (anti-rabbit or anti-mouse IgG conjugated with horse radish peroxidase at 1:10 000, Promega). The membranes were then revealed using an ECL kit (GE Healthcare ...
-
bioRxiv - Cancer Biology 2023Quote: ... We co-transfected cells with the Tol2 GIV transposon and a Tol2 transposase (Vector Builder) at a 3:1 ratio of micrograms of plasmid DNA using Fugene 6 (Promega) according to the manufacturer’s directions ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR was used to amplify the coding regions of the steroid receptor genes and to linearize the expression plasmids pHTN HaloTag CMV Neo or pFLN-1 NanoLuc (Promega #N1811 ...
-
bioRxiv - Microbiology 2023Quote: ... For transient expression experiments each well was transfected with 100 ng of DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Twenty-four hours after transfection or doxycycline stimulation ...
-
bioRxiv - Biophysics 2023Quote: ... Bacmids for the wild type and all Xl-HAS-1 mutants were purified from 3 white colonies and transfected into Sf9 cells at 1×106 cells/mL using the FuGene reagent (Promega). Cells were maintained in ESF921 medium (Expression Systems ...
-
bioRxiv - Neuroscience 2023Quote: ... the washed beads were re-suspended in 150 µl trypsin digestion buffer and incubated for 4 hours with 1 µg trypsin (Promega) at 37 °C ...
-
bioRxiv - Genomics 2023Quote: ... Supernatant was removed and pellet was resuspended in 400 µL of sort buffer (1 mM EDTA 0.2 U/µL RNase inhibitor (Promega, N211B), 2% BSA (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples containing 20-30 pmol rhodopsin were mixed with 100-250 fmol BSA and cleaved with 1 μg trypsin/LysC mix (Promega) using the SP3 beads protocol described in [29].
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 40,000 cells per well were seeded into poly-D-lysine-coated 96-well plates (Brand, 781965) and the Halo-ligand was added (1:2,000; Promega, G980A). For each transfection ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... was co-transfected at a 1:5 ratio with either the HaloTag-ubiquitin plasmid (expressing Ub-Halo) or the HaloTag control (Promega). Transfected cells were incubated for 20 h at 37 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... 1.5 µg of the pAC8RedNK vector and 0.5 µg of linearized baculoviral DNA were concurrently transfected into 1×106 Sf9 cells using 6 µl of FuGene HD (Promega) in ESF 921 Insect Cell Culture medium (Expression Systems) ...
-
bioRxiv - Cell Biology 2023Quote: ... Isolated proteins were digested with 1:50 w/w LysC (Wako Chemicals, cleaves at the carboxylic side of lysine residue) and 1:100 w/w trypsin (Promega, Sequencing-grade ...
-
bioRxiv - Cell Biology 2023Quote: ... diluted 1:100 in storage buffer and analyzed as indicated in the manufacturer’s protocol (LDH-Glo Cytotoxicity Assay, Promega, #J2381).
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 cells in a 6-cm dish were transiently transfected with 1 μg of pGloSensor-22F cAMP plasmid (Promega, USA) and 1 μg of human wild-type or mutated A2AR or A2BR overexpression plasmid using polyethyleneglycol (6 μl ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were plated at a density of 1*10^6 per 10cm plate and transfected on the following day using Fugene HD (Promega, Madison ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA -TBST for 1h at room temp ...
-
bioRxiv - Molecular Biology 2023Quote: ... The library preparation involved using 100 ng of genomic DNA spiked with 1% (w/w) of unmethylated lambda DNA from Promega. Subsequently ...
-
bioRxiv - Microbiology 2023Quote: ... and LgBiT Protein (1:100)/HiBiT Lytic Substrate (1:50) in Nano-Glo HiBiT Lytic Buffer (25 μl) (Nano-Glo HiBiT Lytic Detection System; Promega) were mixed and incubated for 10min at room temperature according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNAs were obtained from 400 ng of RQ1-treated RNA using 1 μl of GoScript Reverse Transcriptase (Cat. No. A5003; Promega) in a 20-μl final volume reaction using random primers (Cat ...
-
bioRxiv - Biophysics 2023Quote: ... Samples were diluted 5-fold with 25 mM Tris pH 8.0 and 1 mM CaCl2 prior to digesting them with trypsin (Promega, V511X) at a 1:30 enzyme-to-protein ratio at 37 °C in a dry bath for 16 h.
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... PCR reaction mixtures were solved in 1% (w/v) agarose gel and purified using Wizard SV gel & PCR Clean-Up kits (Promega). Then ...
-
bioRxiv - Bioengineering 2023Quote: ... tumor fragments (200-300 mg) were lysed for 1 h on ice with agitation in 1X Reporter Cell Lysis Buffer (Promega) and then centrifuged at 14,000 x g for 15 min at 4°C ...
-
bioRxiv - Bioengineering 2023Quote: ... 2000 transfected cells were replated into white 384-well tissue culture plates in the presence or absence of 1 μM HaloTag NanoBRET-618 Ligand (Promega) and incubated overnight at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA-expressing lentiviruses were generated by co-transfecting 293T cells with pLKO-puro.1 vectors and the packaging vectors ΔVPR and VSVG (FuGENE, Promega). Viruses were harvested 24-48 h post transfection ...
-
bioRxiv - Cell Biology 2022Quote: Halo-3F-SOCS1 expression was induced with doxycycline overnight (1 μg/mL) and Halo-tagged protein detected by incubation with fluorescent Halo TMR ligand (10 nM; Promega) overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... Strap binding buffer was applied to precipitate proteins on quartz and proteolysis took place during 14 hrs at 37°C with 1 µg Trypsin sequencing grade (Promega). After speed-vacuum drying of eluted peptides ...
-
bioRxiv - Systems Biology 2023Quote: ... The urea in the lysis buffer was then diluted to a final concentration of 1 M with 50 mM ammonium bicarbonate followed by trypsin digestion (Promega) with enzyme ...
-
bioRxiv - Genetics 2023Quote: ... Protein mixtures were diluted in 1:6 ratio (v/v) using ultrapure water prior to digestion using sequencing grade trypsin (Promega) at 37 °C for 16 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... we transfected 500,000 ANBL6 cells with 1 ug of reporter plasmid plus 250 ng of Rinella plasmids pRL-SV40 and pGL3 control (Promega) in biological triplicates ...
-
bioRxiv - Genomics 2023Quote: ... Primary antibodies were revealed using species-appropriate HRP-conjugated secondary antibodies (anti-rabbit or anti-mouse IgG (1:5000, Promega), or anti-guinea pig IgG (1:5000 ...
-
bioRxiv - Cell Biology 2023Quote: ... The antibodies used for western blotting were: anti-HALO (1:1000 in 0.5% milk TBST, 4°C o/n, Promega G9211), anti-GAPDH (1:10000 in TBST ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were washed with 1× PBS and lysed with PLB according to the manufacturer’s instruction for 15 mins (Promega, E1910). Cells were transferred to a 96-well plate ...
-
bioRxiv - Cancer Biology 2023Quote: ... The isolated RNAs (20 ng) were reverse-transcribed and quantitative PCR (qPCR) were perform using GoTaq Probe 1-Step RT-PCR system (Promega) in a QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems) ...
-
HIVtat Alters Epithelial Differentiation State and Increases HPV16 Infectivity in Oral KeratinocytesbioRxiv - Microbiology 2023Quote: ... Blots were washed twice with 1X PBS-T followed by incubation for 1 hour with HRP-conjugated secondary antibody (Promega) diluted 1:10,000 in PBS-T ...
-
bioRxiv - Microbiology 2023Quote: ... Blots were washed twice with 1X PBS-T followed by incubation for 1 hour with HRP-conjugated secondary antibody (Promega) diluted 1:10,000 in PBS-T ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfection was performed with 1 μg of plasmid DNA in combination with 3 μL of Fugene HD transfection reagent per well (Promega).
-
bioRxiv - Cell Biology 2023Quote: ... packed column (now loaded with the protein sample) 20 µL of Trypsin digestion solution (1 µg MS-grade Trypsin (Promega) in 50 mM ammonium bicarbonate ...