Labshake search
Citations for Promega :
201 - 250 of 4197 citations for Mouse VPS10 domain containing receptor SorCS1 SORCS1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... and anti-mouse (1:3000; Promega #W4021) were used for detection with chemiluminescence (HyGLO Chemiluminescent HRP Antibody Detection Reagent ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-β-gal (Promega 1:500), chicken-anti-GFP (Invitrogen 1:1000) ...
-
bioRxiv - Plant Biology 2020Quote: ... anti-mouse IgG horseradish peroxidase conjugate (Promega). For primary antibody decoration ...
-
A rare variant on a common risk haplotype of HFE causes increased risk of hereditary hemochromatosisbioRxiv - Genetics 2019Quote: ... and anti-mouse HRP (Promega W-4021) antibody ...
-
bioRxiv - Microbiology 2019Quote: ... Anti-mouse conjugated to HRP (Promega, USA) was diluted 1:5000 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-β-gal (Promega 1:500), chicken-anti-GFP (Invitrogen 1:1000) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and Mouse anti-βGal (1:1000, Promega). The following antibodies were obtained from the Developmental Studies Hybridoma Bank ...
-
bioRxiv - Physiology 2021Quote: ... anti-rabbit or anti-mouse HRP (Promega) was diluted in TBS containing 0.05% Tween-20 and 5% dry nonfat milk ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-Beta Galactosidase (1:1000, Promega), mouse anti-Beta Galactosidase (1:10 ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-ß Galactosidase 1:200 (Promega), anti-ß Galactosidase 1:500 (Cappel) ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse anti-β-Gal (Promega, 1:1000); mouse anti-En (Hybridoma Bank ...
-
bioRxiv - Immunology 2022Quote: ... the mouse FcγR-IV ADCC Bioassay (Promega) was used ...
-
bioRxiv - Genetics 2022Quote: ... Horseradish peroxidase-conjugated anti-mouse-IgG (Promega), anti-rabbit-IgG (Promega) ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse anti-βgal 1:1.000 (Promega, Z378A) rabbit anti-GFP 1:300 (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Mouse anti-HiBiT tag mAb (30E5, Promega) and goat anti-mouse IgG H&L conjugated with Alexa Fluor 568 (Abcam ...
-
bioRxiv - Immunology 2023Quote: ... HRP-anti-Mouse IgG (H+L) (Promega).
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-β-III-tubulin (Promega, G7121), mouse anti-acetylated alpha Tubulin Antibody (6-11B-1 ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-Mouse-HRP (1:20000, Promega W4021) and anti-Rat-HRP (1:20000 ...
-
bioRxiv - Neuroscience 2024Quote: ... goat anti-mouse IgG (Promega, 1:10,000), goat anti-rabbit IgG (Promega ...
-
bioRxiv - Molecular Biology 2019Quote: ... incubated with anti-mouse or anti-rabbit HRP-conjugated secondary antibody for 30min (anti-mouse IgG HRP conjugate Promega #W402B ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were transfected with transfection mix containing 50 μL FuGENE HD (Promega) and 1000 μL Opti-MEM (Thermofisher ...
-
bioRxiv - Molecular Biology 2019Quote: ... 100 μL 40mM ABC containing 0.5 μL of trypsin gold (Promega, V528A) in PBS was added to each sample and samples were incubated overnight at 37°C in a closed ...
-
bioRxiv - Bioengineering 2019Quote: ... permeabilized with tris-buffered saline (TBS) containing 0.5% Triton X-100 (Promega), and blocked with AbDil (2 wt % bovine serum albumin (BSA ...
-
bioRxiv - Pathology 2020Quote: ... respectively) containing β-galactosidase (1 mg/ml; Cat # V394A; Promega, Madison, WI). Samples were post fixed in formalin overnight and then stored in ethanol (70%).
-
bioRxiv - Microbiology 2019Quote: ... containing 500 μl of nuclease free water (Cat. N°. P119C/Promega/U.S.A). The upper part of the swabs was cut using sterile scissors to allow closing of the tube ...
-
bioRxiv - Molecular Biology 2020Quote: ... A transfection solution containing 2 μl oligo-fectamine (Promega, Madison, WI, USA), 40 μl MEMI ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM DTT] containing 0.5 mM of freshly added rATP (Promega, E6011) in 10-μl reactions ...
-
bioRxiv - Cell Biology 2021Quote: ... containing 100 nM bafilomycin A1 and 37.5 nM TMRDirect Halo Ligand (Promega). After 2 hours in EBSS ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pGL3-basic plasmid containing a reporter gene was purchased from Promega Co ...
-
bioRxiv - Physiology 2021Quote: ... pH 8) containing a cocktail of protease inhibitors (Promega Corporation, Madison, WI) using a Precellys24 and 2 mm zirconium oxide beads (2 x 25 s at 6800 rpm ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.5% Sodium deoxycholate and 0.1% SDS) containing protease inhibitors (Promega, Madison, USA) and centrifuged at 10,000× g (30 min at 4°C) ...
-
bioRxiv - Microbiology 2020Quote: ... containing 13.5 μL of GoTaq Green Master Mix (Promega, Cat No.: M7123), 1.5 μL of Human GAPDH Forward Primer (5’– AGAAGGCTGGGGCTCATTTG–3’) ...
-
bioRxiv - Molecular Biology 2020Quote: ... this was assessed using a luciferase positive control pGL3 containing SV40 (Promega) and trypan blue staining ...
-
bioRxiv - Molecular Biology 2021Quote: ... 80 µl of PNK buffer containing 4U Thermosensitive Alkaline Phosphatase (TSAP) (Promega) and 2µl RNasin® (Promega ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 μl 5X colorless GoTaq reaction buffer (containing 7.5 mM MgCl2) (Promega), 6.225 μl deionized water ...
-
bioRxiv - Microbiology 2021Quote: ... dNTP nucleotide mix containing 200 µM concentrations of each nucleotide (Promega, USA), and 1.25U of GoTaq DNA polymerase (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... and pGL4.74 containing the Renilla luciferase reporter gene (0.5 μg/dish, Promega), as an internal control ...
-
bioRxiv - Immunology 2020Quote: ... Washed beads were resuspended in 50mM ammonium bicarbonate containing 25ng trypsin (Promega) by brief bath sonication and incubated at 37°C O/N ...
-
bioRxiv - Immunology 2020Quote: ... followed by a medium change to supplemented DMEM containing 1µM luciferin (Promega). Data were further processed and analyzed using Chronostar 3.0 [49].
-
bioRxiv - Biophysics 2022Quote: ... and PiggyBac transposon plasmid containing puromycin selection using FuGENE (Promega, Madison, WI) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... containing flanking sequences that matched the pNL3.2NF-κB-RE plasmid (N111A, Promega). The pNL3.2NF-κB-RE plasmid was PCR amplified with primers containing sequences flanking the 5’UTR ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by 25 μL of the HBSS containing GloSensor cAMP Reagent (Promega). Plates were kept in a dark place at room temperature for two hours to equilibrate cells with the reagent ...
-
bioRxiv - Cell Biology 2023Quote: ... neurons were incubated in media containing 50nM JF646 HaloTag ligand97 (Promega GA1120) or JFX554 HaloTag ligand98 (Kind gift of L ...
-
bioRxiv - Microbiology 2024Quote: ... which included a 5 µl nucleotide mix containing 2.5 mM NTPs (Promega). For each reaction ...
-
bioRxiv - Microbiology 2023Quote: ... generated by cloning the entire coding sequence of mouse APOBEC1 (mAPOBEC1) amplified from mouse cDNA by PCR into pGEM-T-easy (Promega), and cloning it into the EcoRI and SalI sites of pEGFP-C2 (Clontech) ...
-
bioRxiv - Cell Biology 2020Quote: ... and anti-mouse HRP conjugate secondary (Promega W401B). Probing of Mcm2-7 using UM174 antibody was performed using 12% gels in order to compress signal from the six MCMs into a compact region to facilitate quantification ...
-
bioRxiv - Developmental Biology 2021Quote: ... mouse anti-β-galactosidase (Promega, Z378A; 1/100); mouse anti-Myc (Santa Cruz Biotechnology ...
-
bioRxiv - Developmental Biology 2021Quote: ... β-III TUBULIN (mouse, 1:100 Promega catalogue # G7128), BLBP (rabbit ...
-
bioRxiv - Developmental Biology 2021Quote: ... Mouse anti-β-Gal (1:1000, Promega, Z378A). Uptake assay was performed as described previously (Gomez-Lamarca et al ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse anti-β-galactosidase (1:400, Promega Z3781), rabbit anti-Phospho4EBP1 (1:500 ...