Labshake search
Citations for Promega :
1801 - 1850 of 4085 citations for 2 1H Imidazol 1 yl 6 methyl 4 pyrimidinemethanamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... 1 µg trypsin (Promega, Fitchburg, USA) was used to digest 50 μg of total solubilized protein from each sample ...
-
Arc mediates intercellular synaptic plasticity via IRSp53-dependent extracellular vesicle biogenesisbioRxiv - Neuroscience 2024Quote: ... and nanoluc substrate (Promega, 1:200) diluted in 1X passive lysis buffer (Promega) ...
-
Arc mediates intercellular synaptic plasticity via IRSp53-dependent extracellular vesicle biogenesisbioRxiv - Neuroscience 2024Quote: ... and nanoluc substrate (Promega, 1:200) diluted in 1X passive lysis buffer (Promega) ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 μg of trypsin (Promega, V5280) was added ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.1 µl 1% digitonin (Promega,#G9441), 0.1 µl 10% Tween-20 (Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... anti-LgBiT (1:500, N7100, Promega), anti-MCPyV LT (1:500 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 10 U μl-1 RNAsin (Promega), 1Å∼ Superscript II First-Strand Buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:100 RNasin Plus (Promega N2615), and 1:200 Alexa Fluor 488 anti-GFP antibody (BioLegend 338007 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... against 1 kb DNA ladder (Promega) and photographed under UV illumination (see Supplementary Figures S3 and S4 for examples) ...
-
bioRxiv - Immunology 2023Quote: ... 1 Inflammasome Assay was from Promega. HTRF kits to detect IL-1b ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 µl 10 mM dNTPs (Promega), 1 µl 0.1 M dithiothreitol (Invitrogen) ...
-
bioRxiv - Biophysics 2022Quote: ... 1 ng of Trypsin Gold (Promega) was added ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 μL NanoGlo substrate (Promega, N1110) was added at a final dilution of 2100-fold after 30 min incubation at room temperature ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 1 µg trypsin (Promega, Fitchburg, USA) was used to digest 50 μg of total solubilized protein from each sample ...
-
bioRxiv - Neuroscience 2023Quote: ... Trypsin (1:100, Promega, Cat # V5280) was then added for overnight incubation at 37°C with intensive agitation (1000 rpm) ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-Halo (1:1000, mouse, Promega), anti-Myc (1:100 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 µl Reverse Transcriptase (Promega, M314A). Thermal cycling was as follows ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 µl Reverse Transcriptase (Promega, M314A), was added to each sample ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1:250 RNasin (Promega, #2515). Centrifugally clarified cell extracts were incubated with affinity medium (20 μl of slurry for αORF1p and αORF2p for 30 min at 4 °C ...
-
bioRxiv - Microbiology 2024Quote: ... rabbit anti-Halo (1:300, Promega), rabbit anti-H3K9me3 (1:300 Abcam ...
-
bioRxiv - Physiology 2024Quote: ... HRP Conjugate (1:2,500, Promega, W4011) secondary antibody for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... goat anti-VAChT (1:500, Promega); rabbit anti-Cartpt (1:2500 ...
-
bioRxiv - Genomics 2024Quote: ... 1 U/µl RNAsin (Promega, N2515) in molecular biology-grade water ...
-
bioRxiv - Genomics 2024Quote: ... 1 U/µl RNAsin (Promega, N2515) in PBS ...
-
bioRxiv - Genomics 2024Quote: ... 1 U/µl RNAsin (Promega, N2515) in molecular biology-grade water ...
-
bioRxiv - Genomics 2024Quote: ... 1 U/µl RNAsin (Promega, N2515) in molecular biology-grade water ...
-
bioRxiv - Immunology 2024Quote: ... mixed with 1 mM dNTPs (Promega) and 0.5 µg Oligo(dT)12-18 (Promega ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µL ProteaseMax™ Surfacant (Promega) was added ...
-
bioRxiv - Zoology 2024Quote: ... 1 μl 10 mM dNTPs (Promega), 2.5 μl of each primer at 10 μM ...
-
bioRxiv - Cell Biology 2024Quote: ... FuGene HD (Promega, E2311, 1:3).
-
bioRxiv - Immunology 2024Quote: ... 1 µg sequence grade trypsin (Promega) was added overnight at 25°C ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µg trypsin (Promega, Fitchburg, USA) was used to digest 50 μg of total solubilized protein from each sample ...
-
bioRxiv - Systems Biology 2024Quote: ... 1 μL of random hexamers (Promega), and brought to 20 μL total volume with nuclease-free water ...
-
bioRxiv - Biophysics 2024Quote: ... 1% unmethylated Lambda DNA (Promega #D1521) was spiked into genomic DNA to monitor bisulfite conversion efficiency ...
-
bioRxiv - Molecular Biology 2024Quote: ... Beta-Galactosidase (1/1000e, Promega, Z3781), tropomyosin1 tm1 (1/200e ...
-
bioRxiv - Microbiology 2024Quote: ... 1% NanoGlo Live Cell substrate (Promega) was then added and 300 µL of bacterial culture was then transferred in triplicate into 96-well plates ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-Halo (Promega G9211, 1:1000) at room temperature for 2 hrs.
-
bioRxiv - Evolutionary Biology 2024Quote: ... PBS 1x and 1% BSA (Promega)) for one hour ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 ng of Trypsin Gold (Promega) was added ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 1% unmethylated Lambda DNA (Promega) was added as a control for bisulfite conversion efficiency ...
-
bioRxiv - Microbiology 2024Quote: ... 1:5000 anti-mouse (W402B, Promega), 1:3000 anti-Rat (ab97057 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 U of PNGase F (Promega) in 5 µL 1x PBS was added and samples were incubated overnight at 37°C.
-
bioRxiv - Physiology 2020Quote: ... and single-stranded cDNA was synthesized from each sample (2 μg) with M-MLV reverse transcriptase (#0000113467, Promega Corporation, Fitchburg, WI) and RNase inhibitor (40 U ...
-
bioRxiv - Immunology 2021Quote: ... Products were isolated from a 2% agarose gel using the Wizard1 SV Gel and PCR Clean-Up System (Promega, Mannheim, Germany). DNA concentration was determined via the Qubit1 1.0 Fluorometer (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: We performed the apoptosis analysis of the MPro stable cells and cells transiently transfected with the pLVX-MPro-eGFP-2 plasmid using the RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay kit from Promega. The cells were maintained in high glucose DMEM medium supplemented with 10% FBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... The RSB/RNasin buffer (2 ml) was prepared fresh and contained 200 ul of 10 X RSB and 50 ul RNasin (N2511, Promega, USA). The PEB buffer (10 ml ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative RT-PCR (qPCR) reactions were conducted in a 10-µL total volume using a 2× GoTaq® qPCR Master Mix (Promega) and run on an ABI 7500 qPCR thermocycler (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Neuroscience 2022Quote: ... astrocytes were collected and processed after a 2-hour incubation period to determine intracellular glutamate levels using the Glutamate-Glo™ Assay (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Peptide digestion was initiated by adding 25 μl of 50 mM ammonium bicarbonate buffer (pH 8) containing 2 μg trypsin (Sequencing Grade Modified Trypsin, Promega #V5117) directly on top of the column and incubating overnight at 37 °C in a drying oven ...