Labshake search
Citations for Promega :
1701 - 1750 of 5339 citations for ssc mir 411 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: HEK293 and Vero E6 cell toxicity following fendiline treatment was tested at the indicated time points using the Cell Titer Glo Viability Assay (Promega, Madison WI) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... cells were washed 2 times with phosphate-buffered saline (PBS) and lysed with Luciferase Cell Culture Lysis 5x reagent (Promega, Madison, WI). Using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... cell viability was determined over time course with a a microplate reader using CellTiter-Glo® 3D Cell Viability Assay (Promega, G9683) according to manufacturer’s directions ...
-
bioRxiv - Plant Biology 2023Quote: ... The luminescence activity was then recorded with the integration time of 10 seconds in the GloMax Explorer System (Promega Corp., Madison, WI).
-
bioRxiv - Immunology 2023Quote: ... Cell samples were collected at the indicated times and lysed or assayed using the Dual-Luciferase® Reporter Gene (DLR™) Assay System (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR amplifications for genotyping were performed using GoTaq Green Master Mix (Promega, Madison, WI, USA), with the resulting products subjected to 3% agarose gel electrophoresis (Supplemental Fig ...
-
bioRxiv - Cell Biology 2020Quote: ... The PCR product was digested with XhoI and NcoI and ligated into pGL3-control (Promega). The resulting plasmid ...
-
bioRxiv - Cell Biology 2020Quote: ... The linear PCR products were circularised by ligation with T4 DNA ligase (Promega Cat#M180A) (O/N ...
-
bioRxiv - Cell Biology 2020Quote: ... All PCR reactions on cDNA were performed using the GoTaq DNA polymerase (Promega, Madison, WI) unless otherwise noted ...
-
bioRxiv - Cell Biology 2020Quote: ... This PCR reaction was carried out with GoTaq G2 hot start DNA Polymerase (Promega, F549L). All PCR reactions were in 96-well plates with a Freedom EVO 200 (Tecan ...
-
bioRxiv - Neuroscience 2021Quote: ... The reverse-transcribed cDNA was subjected to quantitative PCR using GoTaq qPCR Master Mix (Promega) and the StepOnePlus™ Real-time PCR system (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... Successful integration was confirmed by diagnostic PCR using GOtaq Hot Start Green Master Mix (Promega). For primer sequences see Supplementary file 1.
-
bioRxiv - Developmental Biology 2022Quote: ... or produced by PCR amplification of a fragment subsequently ligated in pGEMT Easy vector (Promega). Primers used to amplify the fragment of interest are listed in Table S2 ...
-
bioRxiv - Genomics 2019Quote: ... cDNA was amplified with the following protocol: 1X Promega PCR Master Mix (Promega, Fitchburg, WI), 2.5µL cDNA template ...
-
bioRxiv - Microbiology 2019Quote: ... PCR to confirm presence of transposon was preformed using GoTaq® Green Master Mix (Promega) and primers KanF (TGGATTGCACGCAGGTTCTC ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCRs were performed using 7.5 ng of cDNAs with GoTaq polymerase (Promega, Madison, WI, USA). PCR products were separated by ethidium bromide-labeled agarose gel electrophoresis ...
-
bioRxiv - Genetics 2020Quote: ... The PCR products were cloned into pGEM®-T Easy vector (Promega, cat. no: A1360), and ten colonies were selected for sequencing.
-
bioRxiv - Cell Biology 2021Quote: ... were amplified by PCR and cloned into the pGL3-Basic luciferase reporter vector (Promega, E1751) using the KpnI and XhoI sites [promoter sequence defined using the Eukaryotic promoter database (https://epd.epfl.ch//index.php)] ...
-
bioRxiv - Genetics 2019Quote: ... The resulting PCR products were inserted by TA cloning into pGEM-T Easy plasmid (Promega) possessing T7 and SP6 promoters ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR reaction (25 μl) contained 12.5 μl of Go-Taq Master Mixes (Promega, Milan, Italy), 1 µl (25 pmoles ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR reactions were performed using 25ng bisulfite converted DNA using GoTaq® DNA Polymerase (Promega). The TA Cloning Kit (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: Sequences for generating probes were amplified from cDNA by PCR using GoTaq DNA Polymerase (Promega) on a BioRad T100 Thermal cycler ...
-
bioRxiv - Microbiology 2021Quote: ... pRRL.sin.cPPT.SFFV/Firefly-IRES-PuromycinR.WPRE was obtained by amplification of Firefly by PCR from pGL4 (Promega) and cloned into BamHI-XhoI-digested pRRL.sin.cPPT.SFFV/E2-crimson-IRES-PuromycinR.WPRE ...
-
bioRxiv - Physiology 2021Quote: ... PCR products were purified with the Wizard SV Genomic DNA Purification System (Promega, Cat# A2361), and sent in to a commercial sequencing platform (Eurofins Genomics ...
-
bioRxiv - Plant Biology 2020Quote: ... collected supernatant was used as a template in a standard PCR reaction using GoTaq (Promega) with Cas9-specific primers or primers to amplify the gRNA(s ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was conducted with the following reaction conditions: 0.1 U/µL Gotaq (Promega, Madison, WI), 1X Gotaq buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... The amplified product was purified using Wizard SV Gel and PCR Clean-up system (Promega) and inserted into T-Vector pMD20 (Takara Bio ...
-
bioRxiv - Microbiology 2022Quote: ... Barcoded amplicons were purified by the Wizard SV Gel and PCR Clean-Up System (Promega) and quantified using the Qubit dsDNA HS assay ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were cloned into pGEM-T Easy and transformed into DH5α competent cells (Promega). Plasmid DNA was purified using the Qiagen midiprep kit (Qiagne ...
-
bioRxiv - Plant Biology 2021Quote: ... the supernatant was used as a template in a standard PCR reaction using GoTaq (Promega) with Cas9-specific primers (to select primary plant transformant (T0 ...
-
bioRxiv - Microbiology 2021Quote: ... Purified PCR products were cloned into pGEM®-T Easy Vector (Promega, Madison, WI, USA), and transformed into OneShot TOP10 chemically competent Escherichia coli cells (Invitrogen ...
-
bioRxiv - Developmental Biology 2020Quote: ... Equal amounts (according to PCR quantification) were used with the GoTaq qPCR Master Mix (Promega) in a 7300 real-time PCR system (ABI) ...
-
bioRxiv - Plant Biology 2021Quote: ... colony PCR screens were conducted using GoTaq® Green Master Mix (Promega, Madison WI, USA) with the following conditions ...
-
bioRxiv - Plant Biology 2021Quote: Full length Luciferase coding sequence was PCR amplified from the pGEM-luc cassette vector (Promega) using the primer pair ...
-
bioRxiv - Immunology 2020Quote: The murine Linc00402 probe template was generated by PCR (GoTaq Green 2X Master Mix, Promega) amplifying a 368 nt region from C57BL/6 T cell-derived DNA using the following forward and reverse primers containing EcoRI and HindIII sites ...
-
bioRxiv - Neuroscience 2020Quote: ... and the resulting PCR product (3918bp) was cloned into pGEM®-T Easy Vector (Promega). Subsequently ...
-
bioRxiv - Microbiology 2021Quote: ... Amplicons were purified with the Wizard SV Gel and PCR Clean-Up system (Promega Switzerland).
-
bioRxiv - Genetics 2022Quote: ... The digested minigenes were purified with Wizard SV Gel and PCR Clean-UP System (Promega) and ligated into a BamHI/MluI opened pCAS2 splicing reporter minigene vector (kindly provided by Dr ...
-
bioRxiv - Neuroscience 2019Quote: Single cell PCRs were performed on diluted cDNA (1:100) using Go-Taq polymerase (Promega) with the following protocol ...
-
bioRxiv - Plant Biology 2019Quote: ... All PCR reactions were carried out using Go Taq DNA Polymerase (Promega, Madison, WI, USA) and following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... Flnb and Myocd were PCR amplified and cloned into HindIII/EcoRI sites of pGEM4Z (Promega) for in vitro transcription ...
-
bioRxiv - Genomics 2019Quote: Candidate TRs with long alleles identified in NA12878 were PCR amplified using GoTaq (Promega #PRM7123) with primers shown in Supplementary Table 5 ...
-
bioRxiv - Neuroscience 2019Quote: ... The purified PCR product was subcloned into the pGEM-T Easy vector (Promega, Madison, WI) for Sanger sequencing ...
-
Structure and mechanism of a Type III CRISPR defence DNA nuclease activated by cyclic oligoadenylatebioRxiv - Biochemistry 2019Quote: ... Reactions were quenched and deproteinized by PCR Clean-Up System (Promega, Madison, Wisconsin, United States). 10 μl eluted product was incubated with T4 DNA Ligase (New England BioLabs ...
-
bioRxiv - Biophysics 2019Quote: ... or the Wizard® SV Gel and PCR Clean-Up System (Promega GmbH, Mannheim, Germany). All primers were obtained from biomers.net ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR fragments were gel extracted and cloned with the pGEM-T easy Vector system (Promega) and transfected into XL10Gold competent cells (Agilent) ...
-
bioRxiv - Molecular Biology 2020Quote: ... DHRS2 were amplified by PCR from genomic DNA and subcloned into pNL3.1-minP/Nluc (Promega). Cells were transfected with the normalization plasmid (pGL4.54-Luc2/TK) ...
-
bioRxiv - Genomics 2020Quote: ... PCR reactions were run according to the GoTaq® G2 Flexi DNA polymerase instructions (Promega), with 50 ng of template DNA ...
-
bioRxiv - Systems Biology 2019Quote: ... Half of the cDNA (5 μl) was amplified by PCR using Pfu Polymerase (Promega, M7745) with the cycling conditions (95°C for 2 min ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR products were cloned downstream of Renilla luciferase of psiCHECK(TM)-2 vector (Promega) using XhoI and NotI sites.