Labshake search
Citations for Promega :
1601 - 1650 of 5339 citations for ssc mir 411 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Two-rounds of translocation PCR was performed using GoTaq G2 Green Master Mix (Promega). In the first round PCR ...
-
bioRxiv - Neuroscience 2021Quote: ... Probes for in situ hybridization were made by cloning PCR products into pGemTeasy (Promega). 1 µg of the linearized plasmid was transcribed in vitro using NTP labelling mix and T7 or sp6 RNA Polymerase ...
-
bioRxiv - Molecular Biology 2020Quote: ... Amplicons were purified with Wizard® SV Gel and PCR Clean-Up System (Promega) and sequenced via the Eurofins TubeSeq service ...
-
bioRxiv - Cell Biology 2020Quote: ... and purified using the Wizard SV Gel and PCR Clean-up System (Promega, A9281) as per manufacturer directions ...
-
bioRxiv - Immunology 2021Quote: ... The PCR products were inserted into the pGEM-T Easy Vector System (Promega, A1360) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... PCR was performed with the generated cDNA and premixed 2× Taq polymerase solution (Promega) in an MJ Mini Thermal Cycler (BioRad) ...
-
bioRxiv - Microbiology 2020Quote: ... A-tailed PCR amplicons were cloned into p-GEM-T Easy Vector System (Promega) per manufacturer instructions and ligation reactions introduced directly into electrocompetent XL1-Blue E ...
-
bioRxiv - Neuroscience 2021Quote: ... Quantitative PCRs were done in triplicates using the GoTaq qPCR Master Mix (Promega, A6002) and the LightCycler 480 Instrument (Roche Diagnostics) ...
-
bioRxiv - Developmental Biology 2019Quote: ... PCR products were purified and cloned into a pGEM-T Easy vector (Promega, USA) according to the manufacturer’s instruction and the identity of inserts confirmed by sequencing.
-
bioRxiv - Physiology 2020Quote: ... PCR products of correct sizes were extracted and cloned into pGEMT easy vectors (Promega). The inserts (Table S3 ...
-
bioRxiv - Bioengineering 2020Quote: ... and for diagnostic PCR reactions (GoTaq® Green Master Mix (Promega; Art. No.:M7845). PCR was performed according to the respective manufacturer’s instruction ...
-
bioRxiv - Microbiology 2019Quote: ... The concentration of purified PCR products was measured with QuantiFluor™-ST system (Promega). Then the barcode-tagged amplicons from different samples were mixed in equimolar concentration and sent to the Majorbio Bio-Pharm Technology Co. ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... PCR products were purified and cloned into a pGEM-T Easy vector (Promega, USA) according to the manufacturer’ s instruction and the identity of inserts confirmed by sequencing ...
-
bioRxiv - Genomics 2019Quote: ... purified and concentrated using Wizard® SV Gel and PCR Clean-Up System (Promega). Sanger sequencing confirmed correct amplification of PCR fragments ...
-
bioRxiv - Neuroscience 2020Quote: Purified PCR fragments were cloned into a pGEM-T Easy Vector (Promega, Madison, Wisconsin), according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... Reverse ACGTGGCTGCATTAGGAGAG The resulting PCR amplicons (658 bp) were cloned into pGEMT vector (Promega) before Sanger sequencing of individual inserts.
-
bioRxiv - Bioengineering 2020Quote: ... Genotyping PCR assays were performed using GoTaq Green Master Mix (Promega, Madison, WI, USA). The oligonucleotides used in this study (Supplementary Table 8 ...
-
bioRxiv - Cancer Biology 2020Quote: ... adenines were added to the end of the PCR product using Taq polymerase (Promega) before performing a TOPO reaction ...
-
bioRxiv - Neuroscience 2021Quote: ... Resulting products were purified using Wizard SV Gel and PCR Clean-Up columns (Promega) and submitted for Sanger and NGS (Amplicon EZ ...
-
bioRxiv - Plant Biology 2021Quote: ... The cDNA template was used for PCR reaction with GoTaq Green Master Mix (Promega). The primers for RT-PCR are listed in Supplemental Table S1.
-
bioRxiv - Evolutionary Biology 2020Quote: ... Each remaining product was purified using Wizard® PCR Preps DNA Purification System (Promega). PCR products were subsequently cloned into pGEM®-T Easy Vector plasmids in a JM109 High- Efficiency Competent Cells (Qiagen ...
-
bioRxiv - Physiology 2020Quote: ... We used the resulting cDNA to perform quantitative PCR with GoTaq master mix (Promega), and analyzed data with the standard ΔΔCt method ...
-
bioRxiv - Microbiology 2021Quote: ... Products were cleaned with the Wizard SV Gel and PCR Clean-Up System (Promega) and cloned with the pGEM-T easy Vector Systems (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... All integron PCRs were performed using GoTaq® Colorless Mastermix (Promega, Madison, Wisconsin, USA), 0.4 μM of each primer and 2 μL DNA (boil preparation method ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR products were verified by sequencing and ligated into the pGL3-Control vector (Promega), downstream of the luciferase reporter gene ...
-
bioRxiv - Cell Biology 2021Quote: ... and the targeted region was amplified by Taq polymerase PCR (cat. num. M7501, Promega). Sequence verification was achieved by TOPO-cloning (cat ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were digested using restriction enzymes NcoI and XhoI (Promega, Madison, WI, USA) and ligated into pre-digested expression vector pET28a ...
-
bioRxiv - Microbiology 2019Quote: ... which was then purified using the Wizard Gel and PCR Clean-Up System (Promega) and submitted to a third party for sequencing.
-
bioRxiv - Molecular Biology 2019Quote: ... This cDNA was then used for PCR with GoTaq G2 Flexi Polymerase (Promega, M7801), using a forward primer annealing to the 3’ UTR of the mRNA of interest (all primer sequences in Supplementary Table 5 ...
-
bioRxiv - Cell Biology 2019Quote: ... gel purified-PCR products were ligated into NheI/NcoI-digested pGL3-basic vector (Promega) immediately upstream of the luciferase start codon ...
-
bioRxiv - Cancer Biology 2020Quote: ... Equal quantities of tumor genomic DNA were amplified by PCR with GoTaq (M7123, Promega) using the gene-specific primers listed ...
-
bioRxiv - Molecular Biology 2019Quote: ... The resulting PCR product was subcloned into the promoterless pNL1.1[Nluc] vector (Promega, # N1001) using OE-PCR as described by Bryksin and Matsumura (24) ...
-
bioRxiv - Cell Biology 2021Quote: PCR fragments were cloned into the pGEM-T Easy plasmid (Promega Corporation, Madison WI) under the conditions established by the manufacturers and E ...
-
bioRxiv - Genomics 2021Quote: ... PCR was performed according to standard procedures using GoTaq Colorless Master Mix (Promega, M7832) on sperm ...
-
bioRxiv - Cancer Biology 2020Quote: ... The Alu PCR product was cloned into using pGEM-T Easy Vector (A1380, Promega). The clones obtained were subjected to Sanger sequencing for verification ...
-
bioRxiv - Molecular Biology 2020Quote: The PCR mix included 10 µl Green GoTaq DNA polymerase mix (Promega, Madison, USA) with 200 nM of each primer and 10 ng genomic DNA ...
-
bioRxiv - Plant Biology 2020Quote: ... Cloning of The PCR products were performed in the vector pGEM®-T (Promega) containing the lactose operon and the gene coding for ampicillin resistance and then transformed into chemocompetent bacteria (DH5 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and parental allele-specific PCR probes and GoTaq Green Master Mix (Promega cat.#M712). Clones that tested positive by PCR were further validated by western blotting for eS25 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... PCR was run for 30 cycles using GoTaq® G2 Green master mix (Promega) and specific primers ...
-
TRANSITION OF PODOSOMES INTO ZIPPER-LIKE STRUCTURES IN MACROPHAGE-DERIVED MULTINUCLEATED GIANT CELLSbioRxiv - Cell Biology 2020Quote: ... PCR was performed with the generated cDNA and premixed 2× Taq polymerase solution (Promega) in an MJ Mini Thermal Cycler (BioRad) ...
-
bioRxiv - Microbiology 2020Quote: ... followed by extraction using the Wizard SV gel and PCR clean-up system (Promega). The purified candidate genes were cloned into pCR8/GW/TOPO entry vectors (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting PCR product was cloned into the pGEM-T Easy vector system (Promega) and then digested with the restriction enzymes ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR products were purified and cloned into the pGEMT vector (Promega, Madison, WI, USA). pCRC and each gene coding fragments were linked by a double digestion with XhoI and a specific restriction enzyme which cuts within the pGEM-T polylinker (AatII or SacI depending on the pCRC and coding sequences orientation in the pGEM-T ...
-
bioRxiv - Genomics 2020Quote: ... PCR was performed according to standard procedures using GoTaq Colorless Master Mix (Promega, M7832) on sperm ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was purified with the Wizard® SV Gel and PCR Clean system (Promega). The DNA concentration of amplicon was measured by NanoDrop (ThermoFisher) ...
-
bioRxiv - Microbiology 2022Quote: ... were purified using Wizard® SV Gel and PCR Clean-Up System (Promega, USA), and then directly sequenced in both directions by Macrogen Inc ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCR products were purified and cloned into a pGEM-T Easy vector (Promega, A1360) according to the manufacturer’s instructions and the identity of inserts confirmed by sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... AS-PCR for each allele was assembled using the standard GoTaq DNA polymerase (Promega) protocol ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The PCR was done with GoTaq2 polymerase following the instructions of the manufacturer (Promega) and the following PCR protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... All LDI-PCR products from each sample were pooled and quantified using Quantus (Promega). 5-20 ng of the pooled PCR product was analyzed using Tapestation (Agilent) ...