Labshake search
Citations for Promega :
1701 - 1750 of 1921 citations for L β Homo β 2 hydroxyphenyl glycine; R 3 Amino 3 2 hydroxyphenyl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2024Quote: ... the samples were diluted with 50 mM HEPES (pH 8.5) to reduce urea concentration to 2 M and further digested overnight with trypsin (Promega, 1:50 w/w) at RT ...
-
bioRxiv - Biochemistry 2024Quote: ... was synthesised from 2 µg of total RNA using the Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT; Promega, Madison, WI, USA) using random primers and oligo-dT primers (3:1 mol ...
-
bioRxiv - Bioengineering 2023Quote: ... this template was generated from the cDNA of SARS-CoV-2 AI/I-004/2020 using the T7 RiboMAX Express Large Scale RNA Production System (Promega, Madison, WI, USA). The primers and probe used to detect the WK-521 strain were as follows ...
-
bioRxiv - Cancer Biology 2023Quote: ... viable cells were quantified in a FLUOstar OPTIMA ELISA reader (550/590 nm) about 2 h after CellTiter-Blue staining (Promega, Cat No. G8081). Mean values +/-standard deviations (SD ...
-
bioRxiv - Plant Biology 2023Quote: ... and 2 µg of RNA were used for reverse transcription into complementary DNA (cDNA) using M-MLV Reverse Transcriptase (Promega, Madison, WI, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: Affinity purified proteins retained on beads were resuspended in 100 µL of NH4HCO3 at 25 mM containing 2 µg of Trypsin/Lys-C mix (Mass Spec Grade, Promega, Madison, WI, USA). Digestion was performed under agitation at 37°C during 4h ...
-
bioRxiv - Cell Biology 2024Quote: ... beads were equilibrated in 50 mM of ammonium bicarbonate with 2 washes followed by on-bead digestion with trypsin (800 ng; Promega cat. nr. V5280) overnight at 37 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... membranes were washed 3 times for 5 minutes in TBST or TBST-XL for mucin-2 and incubated with anti-mouse IgG HRP Conjugate (1:10000, Promega, Cat no. W4021) or anti-rabbit IgG HRP Conjugate (1:10000 ...
-
bioRxiv - Microbiology 2024Quote: ... Peptide digestion was initiated by adding 25 µL of 50 mM ammonium bicarbonate buffer (pH 8) containing 2 µg trypsin (Sequencing Grade Modified Trypsin, Promega, Cat. no. V5117) directly on top of the column and incubating overnight at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... to a final urea concentration of 2 M for overnight Trypsin/Lys-C digestion at 35°C (1:50 protease:substrate ratio, Mass Spectrometry grade, Promega Corporation, Cat No: V5072).
-
bioRxiv - Immunology 2022Quote: ... the Maxwell Viral Total Nucleic Acid Purification kit (Promega, Madison, WI) was used to isolate viral RNA (vRNA ...
-
bioRxiv - Microbiology 2022Quote: ... Nucleic acid extracts were treated using RQ1 RNAse-free DNAse (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... and subsequently stained with Diamond™ Nucleic Acid Dye (Promega, H1181) for 10 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... and then counterstained with Diamond™ Nucleic Acid dye (Promega Corporation) to visualize competitor oligos ...
-
bioRxiv - Biochemistry 2020Quote: hnRNP L and SETD2 human ORF were procured from Promega. Deletion mutants of hnRNP L and SETD2 were constructed by PCR (Phusion polymerase ...
-
bioRxiv - Biochemistry 2024Quote: ... and 5 units/1 L RQ1 RNase-free DNase (Promega). Lysate was clarified via centrifugation at 17,800 x g for 30 minutes at 4°C.
-
bioRxiv - Molecular Biology 2020Quote: ... After two low stringency washes for 5 minutes each with 2× saline sodium citrate/ 0.1% sodium dodecyl sulfate buffer (2x SSC buffer; Promega Co., Madison, WI, Catalog# V4261) and a high stringency wash for 2 min with 1x SSC buffer ...
-
bioRxiv - Microbiology 2020Quote: ... faginata MAT1-1 isolate using a CTAB-chloroform DNA extraction method (van Diepen et al. 2017) and a MAT1-2 isolate using a Wizard® kit (Promega, Madison, WI, USA) and suspended in 75 µl Tris-EDTA (TE ...
-
bioRxiv - Cancer Biology 2024Quote: ... Each qPCR reaction contained 2 µL cDNA sample (12.5 ng) and 18 µL mastermix with 1X GoTaq® qPCR Master Mix (Promega, Charbonnières les Bains, France) and 0.5 µM primer ...
-
bioRxiv - Cancer Biology 2024Quote: ... to a final urea concentration of 2 M for overnight Trypsin/Lys-C digestion at 35°C (1 µg protease used, Mass Spectrometry grade, Promega Corporation, Cat No: V5072). After acidification ...
-
bioRxiv - Genetics 2020Quote: ... DNA concentration was measured using the QuantiFluor(R)dsDNA System(a) (Promega, USA) following manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... Firefly and Renilla luciferase activities were measured using a luminometer (Promega GloMax(R) Navigator with Dual Injectors) ...
-
bioRxiv - Developmental Biology 2024Quote: ... luciferase expression was assayed using the Dual-Luciferase (R) Reporter Assay System (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... cells were resuspended at 2×106 cells/ml in culture media containing Nano-Glo® Endurazine Live Cell Substrate™ (Promega Inc, WI, USA # N2571) and DrkBiT (Promega Inc ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-rabbit IgG (H+L) HRP conjugate (Promega #W4011, 1:10000), mouse anti-Alix (Abcam #ab117600 ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-mouse IgG (H+L) HRP conjugate (Promega #W4021, 1:10000), anti-rabbit IgG (H+L ...
-
bioRxiv - Biochemistry 2020Quote: ... CaCl2·2H20 (0.99 g/L)) supplemented with 0.05% Tween 20 (Promega), 2.5 mM DTT ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-mouse IgG (H+L) HRP conjugate (Promega #W4021, 1:10000), anti-rabbit IgG (H+L ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-rabbit IgG (H+L) HRP conjugate (Promega #W4011, 1:10000), anti-goat IgG (H+L ...
-
bioRxiv - Molecular Biology 2024Quote: ... anti-mouse IgG (H+L) HRP conjugate (Promega W4021, 1:2,500) and anti-rat IgG (H+L ...
-
bioRxiv - Bioengineering 2021Quote: ... and quantified on a Quantus™ Fluorometer using the QuantiFluor(R) dsDNA System (Promega). The quantification of copies of 16S rDNA was divided by the number of copies naturally present per cell (5 copies·cell-1 according to rrnDB database) ...
-
bioRxiv - Cancer Biology 2023Quote: ... CellTiter 96(R) AQueous MTS Reagent Powder were provided by Promega (Madison, Wisconsin, USA). NdCl3 (>99% ...
-
bioRxiv - Neuroscience 2023Quote: ... miR153 Upstream Seq HindIII R: TATATAAAGCTTCTAAGTAGCTGGCAAAGT) of promoter-less pGL4.10 Firefly luciferase construct (Promega), and the NFAT binding site mutated via site directed mutagenesis (miR153 NFAT Mut F ...
-
bioRxiv - Neuroscience 2020Quote: ... the RNA-bound beads were washed four times in 900 μL of 0.35 M KCl (10 mM HEPES [pH 7.4], 350 mM KCl, 10 mM MgCl2, 1% NP40, 2 mM DTT, 100 U/mL RNasin® Ribonuclease Inhibitors [Promega, N2111], and 100 μg/mL cycloheximide). During the final wash ...
-
bioRxiv - Neuroscience 2020Quote: ... the RNA-bound beads were washed four times in 900μL of 0.35M KCl (10mM HEPES [pH 7.4], 350 mM KCl, 10 mM MgCl2, 1% NP40, 2 mM DTT, 100 U/mL RNasin® Ribonuclease Inhibitors [Promega, N2111], and 100 μg/mL cycloheximide). During the final wash ...
-
bioRxiv - Biophysics 2022Quote: ... spheroplast/sucrose buffer suspension was added to 500 μL warm (42 °C) agarose solution (low melting point agarose, V2831 Promega, 2% w/v in sucrose buffer) using a cut pipette tip ...
-
bioRxiv - Neuroscience 2020Quote: ... the RNA-bound beads were washed four times in 900μL of 0.35M KCl (10mM HEPES [pH 7.4], 350 mM KCl, 10 mM MgCl2, 1% NP40, 2 mM DTT, 100 U/mL RNasin® Ribonuclease Inhibitors [Promega, N2111], and 100 μg/mL cycloheximide). During the final wash ...
-
bioRxiv - Developmental Biology 2024Quote: ... The membranes were washed 3x 10 minutes in TBS-T before being incubated for 2 hours with the secondary anti-mouse-HRP- or anti-rabbit HRP antibody (1:5000, Promega anti-mouse, W4021; anti-rabbit W4011). The membranes were washed in TBS-T for 3x 10 minutes and developed with Western Lightning Plus-ECL reagent (Perkin Elmer NEL104) ...
-
bioRxiv - Genomics 2024Quote: ... pooled PCR fragments > 600 bp in length (300 ng per tube x 2 tubes, each diluted with 100 μl of Promega RQ1 DNase 10x buffer (cat. # M6101)) were lightly digested with 0.2 μl of DNase-I (RQ1 RNase-Free DNase-I ...
-
bioRxiv - Developmental Biology 2023Quote: ... followed by DNA staining with Diamond™ Nucleic Acid Dye (Promega, Madison, WI)
-
bioRxiv - Microbiology 2024Quote: ... RNA was purified according to manufacturer instructions using phenol:chloroform nucleic acid extraction (Promega).
-
bioRxiv - Microbiology 2024Quote: ... or Maxwell 16 Viral Total Nucleic Acid Purification Kit (Promega Corporation, Madison, USA) for viral detection in cell culture supernatant ...
-
bioRxiv - Immunology 2021Quote: ... 1 mM L-Glutamin and 250 μM Luziferin D (Promega, Madison, USA). Cells were incubated 12-16 hours in a humidified incubator at 37°C and 5% CO2 to adhere to the bottom of the plate ...
-
bioRxiv - Microbiology 2023Quote: ... Biotin-oligo d(T) (Promega, #Z5261, 0.2 μmol/L for mRNA FISH); Diethyl Pyrocarbonate (DEPC)-treated water (Invitrogen™ ...
-
bioRxiv - Biochemistry 2022Quote: ... Ethylenediaminetetra-acetic acid (EDTA, 0.5 M, pH 8.0) were purchased from Promega (Madison, WI). Lysyl endopeptidase (Lys-C ...
-
bioRxiv - Genomics 2021Quote: ... Total nucleic acid was then treated with DNase I as recommended (20 units; Promega), re-extracted with phenol/Sevag ...
-
bioRxiv - Molecular Biology 2022Quote: ... SYBR Green I nucleic acid gel stain and Go Taq Hot Start Polymerase (Promega). qRT-PCRs were carried out in a QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Pathology 2022Quote: ... and amniotic fluid using the Viral Total Nucleic Acid Purification Kit (Promega, Madison, WI) on a Maxwell 48 RSC instrument (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... The nucleic acid pellets were resuspended in water and treated with DNAse (RQ1, Promega) for one hour at 37 ºC according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... using either the Maxwell® RSC Viral Total Nucleic Acid Purification Kit (Promega, AS1330) or the Maxwell® RSC miRNA from the Tissue and Plasma or Serum Kit (Promega ...