Labshake search
Citations for Promega :
1651 - 1700 of 3351 citations for 7H Pyrrolo 2 3 d pyrimidine 7 3 5 bis O 2 4 dichlorophenyl methyl 2 C methyl b D ribofuranosyl 4 chloro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer at ...
-
bioRxiv - Microbiology 2020Quote: ... dengue protein NS2B/3/4A constructs were expressed in rabbit reticulocyte lysate (TNT coupled T7, Promega Bio Systems) programmed with 1 µg DNA/50 µL and labeled with 20 µCi of L-[35S]-methionine (EasyTag ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full length 3′UTR and dUTR sequences described above were cloned into a SmaI-digested psiCHECK2 (Promega) vector via blunt-end cloning.
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Neuroscience 2020Quote: ... was incubated for 20 min with a mixture of 57 µL OptiMEM and 3 µL FuGene6 (Promega E2692). After FuGene6/DNA complex formation ...
-
bioRxiv - Microbiology 2020Quote: ... A DENV-1 3’UTR specific probe was generated by PCR reaction with GoTaq Polymerase (Promega, Wisconsin, USA) containing DIG DNA-labelling mix (Roche ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were transfected with the Piggybac plasmid plus transposase at a 3:1 ratio using Fugene HD (Promega) and selected with G418 (300 µg/mL ...
-
bioRxiv - Biochemistry 2022Quote: ... Elution was conducted in 3 beads volume of proteasome buffer containing 1 μL of TEV protease (Promega, PRV6101) for 1 hr at 37°C.
-
bioRxiv - Molecular Biology 2022Quote: Reporter constructs were generated by inserting artificial 3’UTRs downstream of Renilla luciferase of the psiCHECK2 vector (Promega). Briefly synthetic sequences containing three perfect binding sites (TACCTGCACTATAAGCACTTTA ...
-
bioRxiv - Systems Biology 2024Quote: ... followed by a 3:1 dilution with 100mM ammonium bicarbonate and addition of 2µg sequence-grade trypsin (Promega). Samples were digested at room temperature overnight and acidified with formic acid (final concentration 1%) ...
-
bioRxiv - Bioengineering 2023Quote: ... pucks (n=3) for each cell density condition underwent the BacTiter-Glo™ Microbial Cell Viability Assay (Promega), as described in the manufacturer’s instruction manual ...
-
bioRxiv - Cancer Biology 2024Quote: ... Spheroids were treated as indicated for 3 days and viability was measured using 3D CellTiter-Glo (#G9682, Promega) and a GloMax luminometer (Promega).
-
bioRxiv - Neuroscience 2024Quote: ... the wild type and mutated Nnat 3’UTR was inserted into a pmirGLO dual-luciferase expression vector (Promega). Detailed description of the design of these constructs and of the rescue constructs are listed in the supplementary material section ...
-
bioRxiv - Biochemistry 2020Quote: ... Reactions were incubated at 37 °C overnight and subsequently treated with 5 units of DNase (Promega) for 1 hour ...
-
bioRxiv - Physiology 2019Quote: ... USA) and digestion with 150 ng trypsin (5 h, 37 °C Promega, Sequencing Grade, Wisconsin, USA) using a Tecan Freedom EVO robotic liquid handler (Tecan Systems ...
-
bioRxiv - Immunology 2021Quote: ... Infection was measured after 5 days at 37°C by the Luciferase assay system (Promega, USA) according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... For experiments cells were plated onto poly-D-lysine coated glass coverslips supplemented with 1 μM all-trans retinal and transfected using FuGENE® HD (Promega, Madison, USA) the next day ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were examined for viability every 4 to 6 weeks with the CellTiter-Glo assay (Promega). Cell viability was measured in quadruplicates by seeding the cells (2,000 to 3,000 per well in 96-well plate) ...
-
bioRxiv - Biochemistry 2020Quote: ... and cells were lysed at 4 hours post-transfection with 250 μL passive lysis buffer (Promega) and incubated 20 minutes at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... and cells were lysed at 4 hours post-transfection with 250 μL passive lysis buffer (Promega) and incubated 20 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 µL of PBS containing 4 μg/mL Hoechst and 1/10000 CellTox Green Dye (Promega) were were dispensed per well 1 h prior to imaging at Cytation5 image cytometer or Opera Phenix (Perkin Elmer ...
-
bioRxiv - Cancer Biology 2022Quote: ... and NUMB1-4 (from V.O.R.) expression plasmids was performed using FuGENE HD transfection reagent (Promega, E2311) according to the manufacturer’s protocol and selected with Geneticin (Gibco ...
-
bioRxiv - Cancer Biology 2022Quote: ... Viability was measured every 4 days using the CellTiter-Glo luminescent cell viability assay (Promega G7573). A D300e drug dispenser (Tecan ...
-
bioRxiv - Plant Biology 2022Quote: ... and GST- GBF3 were purified from 4 ml culture and immobilized on MagneGST Glutathione particles (Promega). Briefly ...
-
bioRxiv - Cancer Biology 2023Quote: ... or MEK inhibitor U0126 (1, 10, and 50 µM for 4 h; Promega, Madison, WI, USA). A corresponding volume of dimethyl sulfoxide (Nacalai Tesque ...
-
bioRxiv - Cell Biology 2023Quote: ... then transfected with 4 μg pLZRS-GCaMP6 DNA plus 12 μl FuGENE 6 (Promega Cat. #E2691) in 800 μl of Opti-MEM (Thermo-Fisher Cat ...
-
bioRxiv - Biochemistry 2023Quote: ... HRP (4 μM) was added followed by 20 μL of Nano-glo luciferase substrate (Promega, N1110) to each well ...
-
bioRxiv - Cell Biology 2020Quote: ... the artificially synthesized PlGF 3’ untranslated regions (UTR) gene fragment was constructed into pMIR-reporter (Promega, Madison, WI, USA). A complementary sequence with mutation of the seed sequence was designed based on the wild type (WT ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System kit (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer with settings ...
-
bioRxiv - Molecular Biology 2020Quote: Gently re-suspend cells in 100 μl of 3% Glyoxal fixation solution with 1:25 RNasin Plus (Promega N261B) and incubate for 15 minutes on ice.
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNA was quantified to 3 μg to react 1 μg/μL random hexamer (C1181; Promega, Madison, WI, USA) at 70°C for 5 min ...
-
bioRxiv - Genomics 2020Quote: ... 3 ug of pCAG-NLS-Bxb1 was diluted in 250 uL of OptiMEM and 6 uL of Fugene (Promega). On day 2 ...
-
bioRxiv - Cell Biology 2019Quote: ... nuclei from HepG2 cells were isolated by incubating cell pellets in 500 μl of a hypotonic buffer for 15 min on ice (20 mM Tris-HCL, pH 7.4, 10 mM NaCl, 3 mM MgCL2, with protease and phosphatase inhibitor cocktail from Promega). Triton X-100 detergent was added to a 0.5% v:v final concentration to lyse the cells followed by centrifugation at 1200 × g for 10 min to pellet nuclei ...
-
bioRxiv - Cell Biology 2021Quote: ... fumigatus pyrGAf gene and 870 nucleotides of the myoE 3’-UTR region was cloned in pGEM-T easy (Promega). This plasmid was used as template for site-directed mutagenesis (QuickChange kit ...
-
bioRxiv - Molecular Biology 2020Quote: MC Stem-HalV and GUS-(HalV IGR) mRNAs (3 pmol) were translated in 20μl reaction volume of Flexi rabbit reticulocyte lysate (Promega) in the presence of [35S]methionine (>37.0 TBq/mmol ...
-
bioRxiv - Cancer Biology 2021Quote: ... wild-type and mutant MMP2 3′-UTRs were synthesized and recombined into pmirGLO Luciferase vectors (Promega, Madison, WI, USA). Then pmirGLO-Wt/pmirGLO-Mt or miR-1299 mimics/miR-NCs were co-transfected into EC9706/KYSE30 cells ...
-
bioRxiv - Genomics 2022Quote: ADGRG6_3 and ADGRG_4 sequences were PCR amplified from human genomic DNA and cloned into the pGL4.23 plasmid (Promega, E8411). Human preadipocytes ...
-
bioRxiv - Molecular Biology 2019Quote: ... 200 µg lysate was mixed with 0.1 µl RNase A (~3 mg/ml) and increasing concentrations of RNasin (Promega), as indicated ...
-
bioRxiv - Pathology 2021Quote: ... Cytopathic effects of the virus were measured after 3 days using the CellTiter-Glo luminescent cell viability assay (Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2021Quote: ... on a 3.5 cm glass-based dish were transfected with 1.0 μg of EBFP (plasmid DNA) using 3 μL of FuGENE HD Transfection Reagent (Promega) in 10 μL of Opti-MEM (Life Technologies Corporation) ...
-
bioRxiv - Microbiology 2021Quote: ... and NS1 (3′) sequences were determined from purified product cloned into the pGEM-T vector by TA-cloning (Promega) according to the manufacturer’s guidelines.
-
bioRxiv - Microbiology 2020Quote: ... pH 8.0 using Vivaspin columns (3 kDa) and digested separately overnight using trypsin or chymotrypsin (Mass Spectrometry Grade, Promega) at a ratio of 1:30 (w/w) ...
-
bioRxiv - Biophysics 2022Quote: ... DTT was added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37 °C overnight ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were then transfected with plasmid DNA (4µg per plasmid per flask) using FuGENE HD (1:3 ratio; Promega) and cultured at 28°C.
-
bioRxiv - Molecular Biology 2024Quote: ... RT-PCR was used to amplify the OGDH 3’UTR and sub clone it into pmirGLO vector (Promega, UK). 5 × 10^4 C2C12 cells were seeded into 12 well plates ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lysates were diluted 10-fold with 25 mM ammonium bicarbonate and digested with 3 µg of trypsin (Promega, v5111) overnight at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... After 3 days the cells were washed with PBS and lysed with Cell Culture Lysis Buffer (Promega cat. #E1531) prior to firefly and Renilla luciferase activity measurements which were performed in triplicate using the Dual-GLO kit (Promega cat ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were diluted 3 fold with 20mM HEPES pH 8.0 and digested in 10 @g ml-1 trypsin-TPCK (Promega) overnight at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... and 500 ng of lenti-viral transfer plasmids previously described along with 3 µl of Fugene 6 (E2692, Promega) transfection reagent ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... CP4 medium was exchanged with Hanks’Balanced Salt Solution (with added glucose 1 g/l, NaHCO3 0.35 g/l) containing GloSensor cAMP Reagent (3 %, Promega) and plates were incubated for 60 min ...