Labshake search
Citations for Promega :
1351 - 1400 of 4445 citations for Progesterone ELISA Kit 5 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... The Renilla luciferase activity associated with WT or uORF-mutated 5’UTRs was measured according to the manual of the Dual-Luciferase Reporter Assay System (Promega) 32 h after transfection and was normalized to the activity of firefly luciferase.
-
bioRxiv - Biophysics 2024Quote: ... was incorporated at the 5’ end of the FL open reading frame during PCR amplification from a pRL-CMV vector (Promega). A Kozak consensus sequence and a 50-nucleotide upstream region was incorporated before the translation start site to ensure enough space for the assembly of translation initiation complex77 ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2024Quote: ... To quantify the activity of reports groups of 5 embryos were collected 8 hours post-injection in triplicates and lysed in 100 mL of lysis buffer (Promega). Reporter expression was quantified with the Nano-Glo Dual-Luciferase Reporter Assay System (Promega ...
-
bioRxiv - Cancer Biology 2019Quote: ... 50 μl of medium from each well was transferred to another 96-well plate to measure ROS production with ROS-Glo™ H2O2 Assay (Promega, Madison, WI, USA). Remaining plate with cells was used to perform CellTiter-Glo® Luminescent Cell Viability Assay (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... Crystal violet was the solubilized with a 75% ethanol solution and the absorbance was measured at a λ600nm with a plate reader (Promega GloMax Explorer, Promega, France).
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: ... COS-7 cells were plated on 10 cm plates and transfected 24h prior to lysis using FuGENE 6 (Promega; 6-12 µg total DNA). For siRNA tests ...
-
bioRxiv - Cancer Biology 2020Quote: Doubling times for 2D and 3D patient-derived lines were estimated by seeding 1000-5000 cells/well in black 96 well plates and cell viability was measured with CellTiter-Glo (Promega, Southampton, UK, G7571/G9682) every 2-3 days ...
-
bioRxiv - Cell Biology 2023Quote: ... COS-7 cells were plated on 10 cm plates and transfected 24h prior to lysis using FuGENE 6 (Promega; 6-12 µg total DNA). Cells were routinely tested for mycoplasma using a MycoAlert detection kit (Lonza ...
-
bioRxiv - Molecular Biology 2023Quote: ... These cells were transfected in 70% confluent 6-wells TC-treated plates with 2 µg TGFβ receptor-Nanoluciferase constructs (constructs were provided by Promega and Promega R&D) using a 1 µg DNA ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was synthesized with the ImProm II Kit (Promega). qPCR was performed using the Brilliant III Ultra-Fast SYBR® Green QPCR Master mix reagents (Agilent Technologies ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized with a reverse-transcriptase kit (Promega). RNA of cells exposed to SARS-CoV-2 WT was isolated with the QIAamp Viral RNA Mini Kit (Qiagen ...
-
bioRxiv - Microbiology 2019Quote: ... and LEV DNA kit (AS1290, Promega, Madison, WI, US). The filters with collected biomass in lysing matrix E tubes were incubated with 300μL of lysing buffer and 30μL of Proteinase K and incubated at 56°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... luciferase signal was quantified using the DualGlo kit (Promega). Each experiment was performed in triplicate with two biological replicates ...
-
bioRxiv - Molecular Biology 2021Quote: ... the Bactiter-Glo microbial cell viability assay kit (Promega) was used ...
-
bioRxiv - Molecular Biology 2020Quote: ... was subjected to poly(A)+tract isolation kit (Promega). Poly(A)+ enriched RNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... According to the instructions of the detection kit (Promega), the cells were transfected with the luciferase reporter gene level plasmid ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized using the Reverse Transcription kit (Promega). Transcriptional levels of IFN-β ...
-
bioRxiv - Microbiology 2019Quote: ... followed by 350 μL RNA Dilution Buffer (Promega kit) were added to the cell suspensions ...
-
bioRxiv - Genomics 2019Quote: ... with a GoTaq® qPCR master mix kit (Promega). We used two technical replicates for each biological replicate ...
-
bioRxiv - Developmental Biology 2019Quote: ... Luminescence was measured following the kit protocol from Promega.
-
bioRxiv - Biochemistry 2020Quote: ... The pGEM-T Vector kit was purchased from Promega. Acrylamide/bisacrylamide (29:1 ...
-
bioRxiv - Microbiology 2019Quote: ATP was estimated using the BacTiter-Glo kit (Promega). For BDQ or INH treatments in MMA ...
-
bioRxiv - Cell Biology 2019Quote: ... and subsequently analyzed using the GoTaq Green kit (Promega) for analytical RT-PCRs with the primers listed in the Key Resources Table ...
-
bioRxiv - Molecular Biology 2019Quote: ... Maxwell RSC DNA FFPE Kit (Promega Maxwell® RSC), PerkinElmer chemagic FFPE DNA kit (chemagic MSM 1 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... using the Wizard® Genomic DNA Purification Kit (Promega). The kit can be used for at least 100 isolations ...
-
bioRxiv - Genetics 2019Quote: ... using in situ DeadEnd Fluorometric detection kit (G3250-PROMEGA) according to technical protocol (#TB235) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using the Maxwell 16 LEV Plant DNA Kit (Promega), with EcoR1 as the restriction enzyme for generating RAD-seq libraries ...
-
Cytoplasm localized ARID1B promotes oncogenesis in pancreatic cancer by activating RAF-ERK signalingbioRxiv - Cell Biology 2019Quote: Halo tag (Halo pulldown and labeling kit, Promega Corporations) and Streptavidin bead (GE Health care Bio-Science ...
-
bioRxiv - Cancer Biology 2019Quote: ... The dual luciferase assay kit (Promega, Madison, WI, USA) and Glomax 96 Microplate Spectrophotometer (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... Luciferase activity was measured by luciferase assay kit (Promega) using an LMaxII™ microplate luminometer (Molecular Devices) ...
-
bioRxiv - Cancer Biology 2021Quote: FGFR1 kinase enzyme system kit was purchased from Promega Inc ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell lines were authenticated using the GenePrint10 kit (Promega) and matching to their original profiles (ATCC) ...
-
bioRxiv - Cell Biology 2021Quote: ... we used the CellTiter-Glo® Luminescent kit (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Neutralization was measured with a luciferase assay kit (Promega) and plotted relative to the value for control wells.
-
bioRxiv - Plant Biology 2020Quote: ... or Maxwell® 16 LEV Plant RNA Kit (Promega). cDNA was synthesized using Primescript II 1st Strand cDNA Synthesis Kit (Takara ...
-
bioRxiv - Plant Biology 2021Quote: ... using the Maxwell 16 LEV Plant RNA Kit (Promega). RNA was quantified using a NanoDrop (Thermo Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesized using MMLV reverse transcriptase kit (Promega) according to the manufacturers’ protocol with random primers (Promega) ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA was extracted using the Wizard Kit (Promega), as stated above ...
-
bioRxiv - Microbiology 2021Quote: ... The Wizard genomic DNA purification kit (Promega, Madison, WI) was used for isolation of bacterial genomic DNA (gDNA) ...
-
bioRxiv - Cell Biology 2020Quote: A GenePrint 10 System PCR Amplification kit (Promega Corporation) was used to determine the genetic signature of both samples based on the multiplex analysis of 9 loci and the Amelogenin sex-determining marker ...
-
bioRxiv - Cancer Biology 2019Quote: ... Dual-luciferase reporter gene assay kit (Promega, Beijing, China) was used to measure activities of Luciferase ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA synthesised (AMV Reverse Transcriptase kit, Promega, Southampton, UK) and amplified with primers CUE8cDNA-F (CACCATGGCTAACGAAGAACTCAC ...
-
bioRxiv - Microbiology 2022Quote: ... with the Maxwell® RSC Blood DNA kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: Cell Titer Glo Luminescent Cell Viability Assay Kit (Promega) was used and subsequently performed after the BRET measurement ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was synthesized using the reverse transcription kit (Promega) and transcriptional expression of IFIT1 (Fw ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA synthesis was done with reverse transcription kit (Promega) using 50ng of total RNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... using the Maxwell DNA LEV Blood Kit (Promega #AS1290) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... purified using a Wizard Genomic DNA Purification kit (Promega), and sent for Sanger sequencing (ACGT) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Triglyceride-Glo™ Assay kit (Cat#J3160, Promega) from Promega were used according to user’s manual ...