Labshake search
Citations for Promega :
1301 - 1350 of 4445 citations for Progesterone ELISA Kit 5 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... 5 μL of a solution that is 1 mM in each of the 20 essential amino acids (Promega, No. L4461); 20 μl of Promega S30 Premix without Amino Acids (No ...
-
bioRxiv - Immunology 2021Quote: ... The mixture was subsequently incubated with 293TAce2 cells for 48 h after which cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Plant Biology 2021Quote: ... For SlTPD1 a 284 bp DNA fragment from the 5’ coding region was amplified by PCR using cDNA from flowers and cloned into the pGEM-T Easy vector (Promega). For TomA5B and SlSDS genes ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was isolated from approximately 5×105 cells using the ReliaPrepTM RNA Cell Miniprep System (Promega, UK, Cat. Z6012) following product guidelines ...
-
bioRxiv - Molecular Biology 2021Quote: A total of 10 μg of bacmid DNA was transfected into 6 wells of 2×106 adherent Sf9 cells (at 5×105 cells/ml) using the transfection reagent Fugene HD (Promega). 42–72 h post transfection ...
-
bioRxiv - Immunology 2020Quote: ... At 48 h later the cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Immunology 2021Quote: ... extensively washed to remove unbound virus and co-cultured with Huh7.5 for 5 days at 37°C after which they were analyzed for with the Luciferase assay system (Promega, USA) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... that introduced a 5’ KpnI site and a 3’ XhoI site and cloned into the pGL3 firefly luciferase vector (Promega). Site directed mutagenesis was performed as described above ...
-
bioRxiv - Microbiology 2022Quote: ... Huh7.5.1 cells were infected with MLB1 and MLB2 astroviruses (MOI 5) in the presence or absence of 20 µM z-VAD-fmk (pan-caspase inhibitor, Promega). At indicated time post infection ...
-
bioRxiv - Developmental Biology 2022Quote: ... Proteins were on-bead digested using 5 μl of Sequencing Grade Trypsin (100 ng/μl in 10 mM HCl, Promega). The digestion was carried out in a microwave instrument (Discover System ...
-
bioRxiv - Molecular Biology 2022Quote: ... from the EPO gene enhancer (sequence: tcgaagccctacgtgctgtctcacacagcctgtctgacctctcgacctaccggccgttcgaagccctacgtgctgtctcacacagccttct gatctcgacctaccggccgttcgaagccctacgtgctgtctcacacagcctgtctgacctctcgacctaccggccgt) into the 5’ of the minimal TATA-box promoter in the pGL4.23 [luc2/minP] vector (Promega #E841A). A control pHRL-TK vector (Promega #E2241 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Flies were placed individually in 100 ul Chelex solution (5g of Chelex mixed with 95ml TE buffer) with 5 ul proteinase K (Promega), and incubated overnight at 56°C ...
-
bioRxiv - Biochemistry 2022Quote: ... 1.7 μg of attB-hACE2-mNG2-1-10 plasmid or attB-S-mNG2-11 plasmid were added into 5 μL FuGENE 6 transfection reagent (Promega) and OptiMEM (Gibco ...
-
bioRxiv - Immunology 2022Quote: ... or HT1080/Ace2 cl14 cells (for all variant neutralization assays) for 48 hours after which cells were washed with PBS and lysedwith Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysateswas measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Plant Biology 2022Quote: The dual luciferase assay (Figure 1 – figure supplement 5) was based on the Dual- Luciferase® reporter assay system (Promega). N ...
-
bioRxiv - Plant Biology 2022Quote: ... primer extension products reverse-transcribed with a gene-specific primer (reverse-complementary to the 16S rRNA nucleotides 1092-1108; 5’-CAGTCTGTTCAGGGTTC-3’) and AMV reverse transcriptase (Promega) were analyzed by qPCR with the primer pairs ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Kinase activity of phosphorylated CDK2 with cyclin A and varying amounts of inhibitor (dinaciclib or 5) were measured using the ADP-Glo Kinase Assay (Promega) in a luminescence plate reader (Tecan Infinite M1000 PRO) ...
-
bioRxiv - Neuroscience 2022Quote: ... Flag-tagged STAU1 or STAU1RBDΔ3 or Flag plasmids with the wildtype or mutant 5’UTR-MTOR-LUC or luciferase empty vector constructs and Renilla luciferase plasmid (pRL-SV40 vector, Promega) according to an experimental set-up ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mM MgCl2, 1.5 mM KCl, 100 μ g/ml cycloheximide, 1mM DTT, 200 U/ml RNase in from Promega, 0.5% Sodiumdeoxycholate ...
-
bioRxiv - Plant Biology 2022Quote: ... Protein precipitates were resolubilized in 5% trifluoroethanol of aqueous 100 mM TEAB and digested overnight (18 hours) with a Trypsin+LysC mixture (Promega) at a protein to protease ratio of 25:1 ...
-
bioRxiv - Biochemistry 2022Quote: ... with 10 ng pGL4.32[luc2P/NF-κB-RE/Hygro] (NF-κB response element-dependent firefly luciferase) or pGL4 [luc2P/AP-1-RE/Hygro] and 5 ng pRL-TK using the Dual Luciferase Reporter Assay (Promega). 24 hours post transfection ...
-
bioRxiv - Molecular Biology 2022Quote: ... 100 μL of Nano-Glo HiBiT Lytic Detection Reagent was added directly to the cells and incubated for 5 min on an orbital shaker (300 rpm) before recording luminescence on a GloMax Discover (Promega) with 0.2 s integration time.
-
bioRxiv - Immunology 2023Quote: ... samples were diluted 1:1 with water and digested for 1.5 hours at 37 °C with 1 µg of LysC and overnight at 37 °C with 1 µg trypsin (Promega). The peptide mixture was acidified with trifluoroacetic acid (Merck ...
-
bioRxiv - Neuroscience 2023Quote: ... We performed targeted PCR by adding 1 μL of cell lysate (1:5 dilution) to a 25-μL PCR reaction containing GoTaq Hot Start Master Mix Green (Promega) and 0.5 μL of the primers (10 µM ...
-
bioRxiv - Microbiology 2022Quote: ... and alkylated with 5 mM of iodoacetamide 30 min in the dark at RT°C prior to digestion with 5 μg of trypsin Gold (Promega) for 15 h at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 56 °C for 30 seconds and 72 °C for 30 seconds (30 cycles) and 72 °C for 5 minutes using GoTaq DNA polymerase (Promega) and a forward primer (hChimera exon 1-F ...
-
bioRxiv - Neuroscience 2023Quote: ... UDP (at concentrations ranging from 1 nM to 1 mM) was then applied with a final concentration of 5 μM furimazine (NanoLuc Luciferase Assay, Promega). Luminescence was subsequently measured using a Victor X5 multi-label plate reader (PerkinElmer).
-
bioRxiv - Microbiology 2023Quote: ... 5% CO2 before measurement of Renilla and Firefly luciferase activities using Dual-Glo® Luciferase Assay System (Promega, Cat #E2920) and Tecan SPARK plate reader ...
-
bioRxiv - Microbiology 2023Quote: ... were made by replacing the ORF3 region encoding 5–105 amino acids with an in-frame insertion downstream of 4th VP2 codon sequence of UnaG and NanoLuc (Promega) coding regions with their own stop codons ...
-
bioRxiv - Neuroscience 2023Quote: Surface expression was measured using a HiBit-tagged 5-HT2A receptor and the Nano-Glo HiBit Extracellular Detection System (Promega). N-terminal HiBit-tagged human 5-HT2A receptor was cloned into pcDNA3.1 using Gibson Assembly ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... was co-transfected at a 1:5 ratio with either the HaloTag-ubiquitin plasmid (expressing Ub-Halo) or the HaloTag control (Promega). Transfected cells were incubated for 20 h at 37 °C ...
-
bioRxiv - Microbiology 2023Quote: The RNase III.RNA complexes were washed and the 5′ ends of bound RNAs were dephosphorylated with the addition of thermosensitive alkaline phosphatase (Promega). RNA was radiolabelled by phosphorylation with T4 PNK (Sigma-aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... a pPolI-Firefly plasmid encoding the Firefly luciferase sequence in negative polarity flanked by the 5’ and 3’ non-coding regions of the IAV NS segment was used and the pTK-Renilla plasmid (Promega) was used as an internal control ...
-
bioRxiv - Biophysics 2023Quote: ... Samples were diluted 5-fold with 25 mM Tris pH 8.0 and 1 mM CaCl2 prior to digesting them with trypsin (Promega, V511X) at a 1:30 enzyme-to-protein ratio at 37 °C in a dry bath for 16 h.
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... dehydrated with 0.2 mL of 100% acetonitrile and rehydrated with 5 μL of the digestion solution containing 15 μg/mL sequencing-grade trypsin (Promega) in 20 mM aqueous solution of NH4HCO3 ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 mM KCl, 5 mM MgCl2, 2 mM DTT, 100 μg ml-1 cycloheximide, and 20 U ml-1 RNase inhibitor [Promega].) Gradients were centrifuged 36,000 rpm for 2.5 h in a SW41 Ti rotor (Beckman Coulter ...
-
bioRxiv - Cell Biology 2022Quote: ... Tris 50mM pH8.0 and samples were heated 5 min at 90°C before digestion in a mix of 500 ng of LysC (Promega) at 37°C for 2h ...
-
Disruption of the Aspergillus fumigatus RNA interference machinery alters the conidial transcriptomebioRxiv - Microbiology 2023Quote: ... Protein precipitates were resolubilized in 5% trifluoroethanol of aqueous 100 mM TEAB and digested for 18 h with Trypsin+LysC (Promega) at a ratio of 25:1 protein:protease ...
-
bioRxiv - Microbiology 2022Quote: ... cells were co-transfected with RIG-I-2CARD (5 ng) and lysed at 24 hours after transfection using Passive Lysis Buffer (Promega). Samples were processed and luciferase activity was measured using the Dual-Luciferase Assay System (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were maintained at 37 °C and 5% CO2.Cell lines were authenticated using Short Tandem Repeat fingerprinting carried out using the GenePrint 10 system (Promega). For 3D spheroids ...
-
bioRxiv - Molecular Biology 2023Quote: ... The final 50 µL translation reaction included the 5 µL RNA mixture described above and components from the Rabbit Reticulocyte Lysate system (Promega): 35 µL of rabbit reticulocyte lysate ...
-
bioRxiv - Biochemistry 2023Quote: ... The first-strand cDNA was synthesized from 5 µg of the total RNA with an oligo (dT) primer using the AMV reverse transcriptase (Promega). A polymerase chain reaction (PCR ...
-
FACS-Sortable Picoreactors for Ultra High-throughput Screening of Catalysts in Biphasic EnvironmentsbioRxiv - Bioengineering 2024Quote: ... emulsions of octanol + 5% (w/v) Span 80 + 40 µM Nile Red in an aqueous phase of nuclease free water (Promega) + 200 ng/µL miniprepped plasmid + 5% (w/v ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR reactions were conducted in 10 μL volume comprising 5 μL Promega 2x PCR Master Mix (Promega, Madison, Wisconsin, USA), 10 pmol of forward and reverse primers ...
-
bioRxiv - Microbiology 2023Quote: ... The viability of Vero cells treated with 5-FU and EIDD-1931 alone were assessed using CellTiter-Glo Viability Assay (Promega).
-
bioRxiv - Molecular Biology 2024Quote: ... 40 µL of digestion solution (1.25 mM TCEP, 5 mM chloroacetamide, 0.2 µg trypsin/Lys-C mix (Promega, cat#V5073), in 100 mM HEPES pH 8.5 ...
-
bioRxiv - Molecular Biology 2024Quote: About 5 μg empty pcDNA3 vector or ZNF410 full-length and ZNF410-ZF plasmids was transiently transfected with FuGENE 6 (Promega) into 10 cm plates of COS-7 cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then a final solution comprised of 17% formamide + 5% Triethalomine + 70% glycerol + 3% Tris (w/v, Tris, Promega, H5135) made in basic DDH20 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were treated 24h after seeding and cell viability was assessed 5 days after treatment using the Cell Titer-Glo luminescent cell viability assay (Promega). Cells treated with vehicle control DMSO (0.1% ...