Labshake search
Citations for Promega :
1301 - 1350 of 1655 citations for 10 Undecenamide N N bis 2 hydroxyethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Herpes simplex virus 1 entry glycoproteins form stable complexes prior to and during membrane fusionbioRxiv - Microbiology 2022Quote: ... the media of the effector cells was replaced with 40 µl per well of fusion medium (Ham’s F12 with 10% FBS, Penicillin/Streptomycin, 50 mM HEPES) with 1:50 Endurazine luciferase substrate (Promega) added ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were treated with the indicated drugs in combination with pan-caspase inhibitor Z-VAD-FMK (10 mM, Promega). After 24 hours ...
-
bioRxiv - Synthetic Biology 2020Quote: ... at 54°C for 10 min and the resulting cDNA amplified with GoTaq Flexi DNA polymerase (Promega; Madison, WI) for 8 PCR cycles in the same reaction with a final volume of 100 μL ...
-
bioRxiv - Plant Biology 2021Quote: ... Purified nucleus were recovered in 300 μl of Nuclei Lysis Buffer (50 mM Tris-HCl pH8; 0.1% SDS; 10 mM EDTA; 100 μM PMSF; RNasin PROMEGA) and 5 cycles (30 s ON – 30 s OFF ...
-
bioRxiv - Cancer Biology 2019Quote: ... Proteins were pelleted at 20,000 × g and washed with ice cold 10 mM HCl / 90% acetone before resuspension in 60 μL 4 M Urea and 0.5 × ProteaseMax (Promega), vortexed ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were diluted 10-fold with 50 mM HEPES pH 8 and incubated with sequence-grade modified Trypsin (Promega) at 1/50 trypsin/protein ratio for 16 h at 37 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... STR profiling was carried out by PCR amplification of nine STR loci plus amelogenin (GenePrint 10 System; Promega, #B9510), fragment analysis (3730XL DNA Analyzer ...
-
bioRxiv - Immunology 2021Quote: ... Single CD3−CD8−CD14−CD16−CD20+Ova−RBD-PE+RBD-AF647+ B cells were sorted into individual wells of 96-well plates containing 4 μl of lysis buffer (0.5× PBS, 10 mM DTT, 3,000 units/ml RNasin Ribonuclease Inhibitors (Promega, N2615) per well using a FACS Aria III and FACSDiva software (Becton Dickinson ...
-
bioRxiv - Pathology 2021Quote: ... Vero cells were kept in culture in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% of foetal bovine serum (FBS) and transfected using FuGENE HD (Promega) transfectant reagent as suggested by the manufacturer either with a plasmid encoding the Green Fluorescent Protein (GFP ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were lysed by adding 3x lysis buffer (10 mM Tris-HCl, 1.5% Igepal, 150 mM NaCl, 1 U/µl RNasin (Promega)) ...
-
bioRxiv - Microbiology 2019Quote: ... 1 μl (200 nM) of each primer and 10 μl of GoTaq® qPCR Mastermix 2X (Promega Corporation, USA). The amplification program consisted of ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were digested initially with LysC (WAKO) at 37°C for 2.5 h and subsequently with 10 μg trypsin (modified sequencing grade, Promega) overnight ...
-
bioRxiv - Biochemistry 2020Quote: ... Reactions containing 2.5 pmol protein and 3 pmol 32P-labelled RNA were carried out in a volume of 10 µL with 0.5 U/μl RNasin (Promega), 100 mM HEPES(NaOH ...
-
bioRxiv - Neuroscience 2022Quote: ... 1–5 µl of gDNA was mixed with 0.5 µl of 10 mM dNTP mix (Promega, C1141, Madison, WI), 10 µl of 25 mM MgCl2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... into a 10 cm plate of HEK293T cells at 60-70% using Fugene 6 transfection reagent (Promega, Cat #E2691). Media containing lentiviral particles were collected at 24 ...
-
bioRxiv - Immunology 2022Quote: ... The gel pieces were resuspended in 0.1 ml of 100 mM Tris/HCl pH 8.0 containing 10 mM calcium chloride and chymotrypsin (Promega, #V1061) for 16 h at 25 °C ...
-
bioRxiv - Immunology 2022Quote: ... Alkylation was carried out with 10 mM chloroacetamide at room temperature before adding recombinant sequencing-grade trypsin (0.1 μg, Promega). Digestion took place at 37º C for 18 h ...
-
bioRxiv - Microbiology 2023Quote: ... The samples were eluted with TN buffer (10 mM Tris-HCl, pH 8.0, 50 mM NaCl) and quantified using the QuantiFluor ONE dsDNA System (Promega). The resulting barcoded DNA samples were combined in approximately equimolar amounts (a total of 100 femtomoles in 10 µl of TN buffer) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lysates were diluted 10-fold with 25 mM ammonium bicarbonate and digested with 3 µg of trypsin (Promega, v5111) overnight at 37°C ...
-
bioRxiv - Microbiology 2023Quote: RNA was incubated at 95°C for 2 min and on ice for 2 min before 3.3 x RNA folding buffer (100 mM HEPES pH 8.0, 100 mM NaCl and 10 mM MgCl2) and RNasin Plus RNase Inhibitor (Promega) was added to a final volume of 10 μl and incubated for 20 min at 37°C ...
-
bioRxiv - Genetics 2023Quote: ... in Tris 25 mM pH 8.5 in 10% Acetonitrile (ACN) and subjected to overnight trypsin digestion with 0.4 µg of sequencing-grade bovine trypsin (Promega) at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were washed 3 times for 10 min in TBS-T and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10,000; Promega) in 5% non-fat dry milk -TBS-T for 1 h at room temp ...
-
bioRxiv - Bioengineering 2023Quote: ... imaging was performed 10 min after intraperitoneal (i.p.) injection with 200 μL of 15 mg/mL luciferin substrate (Promega). The total flux of luminescence was calculated by gating a region of interest (ROI ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 µL of 1:100 (diluted in phenyl red-free DMEM with 4% FBS) Nano-Glo substrate (Promega N1572) was added in each well ...
-
bioRxiv - Systems Biology 2023Quote: ... according to the manufacturer’s instructions and treated with 6.7 μl of DNase buffer and 10 μl of RQ1 RNase-free DNase (Promega), purified again through a p-30 column ...
-
bioRxiv - Immunology 2022Quote: ... Live single Zombie-NIR−CD14−CD16−CD3−CD8−CD20+Ova−N-loop-PE+N-loop- AF647+ B cells were single-cell sorted into 96-well plates containing 4 μl of lysis buffer (0.5× PBS, 10 mM DTT, 3,000 units/ml RNasin Ribonuclease Inhibitors [Promega, N2615]) per well using a FACS Aria III ...
-
bioRxiv - Cell Biology 2022Quote: ... Three hundred micrograms of each sample were diluted 10 times with 20 mM Tris and digested with 1.5 μl of Mass Spectrometry Grade Trypsin Gold (#V5280, Promega) at 37 °C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were diluted 3 fold with 20mM HEPES pH 8.0 and digested in 10 @g ml-1 trypsin-TPCK (Promega) overnight at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... Live single Zombie-NIR−CD14−CD16−CD3−CD8−CD20+Ova−peptide-PE+peptide-AF647+ B cells were single-cell sorted into 96-well plates containing 4 μl of lysis buffer (0.5× PBS, 10 mM DTT, 3,000 units/ml RNasin Ribonuclease Inhibitors [Promega, N2615]) per well using a FACS Aria III ...
-
bioRxiv - Genomics 2023Quote: ... in a final volume of 10 µL starting from 0.03 µg of DNase- treated (RQ1 Rnase-free Dnase supplemented with Rnasin Ribonuclease Inhibitor; Promega) total RNA ...
-
bioRxiv - Microbiology 2023Quote: ... the DNA-coated beads were added to the interaction mixture (BB 1x : 20mM HEPES pH7.9, 100mM KCl, 5mM, 10% Glycerol; supplemented with 160µg acetylated-BSA (Promega R396A), 1.44nmol ds oligoB ...
-
bioRxiv - Bioengineering 2023Quote: ... 250 rpm.10 µl of each culture was collected for the luciferase assay (Promega, Nano-Glo Luciferase Assay System). Cells were diluted in 90 µl media ...
-
bioRxiv - Developmental Biology 2023Quote: ... HEK293 culture medium was replaced by imaging medium containing either Janelia Fluor 646 (JF646) ligand (10 nM; Promega, #GA1120) or OregonGreen ligand (50 nM ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNAs were collected from a 10-cm dish directly in 400 μl of 1x Reporter lysis buffer (Promega) containing 0.16 U/μl Ribosafe RNase inhibitors (Bioline) ...
-
bioRxiv - Neuroscience 2024Quote: ... 1–5 µl of gDNA was mixed with 0.5 µl of 10 mM dNTP mix (Promega, C1141, Madison, WI), 10 µl of 25 mM MgCl2 ...
-
bioRxiv - Biochemistry 2024Quote: Each sample was rehydrated at 4 °C for 30 min by adding the same volume of 10 ng/µL trypsin in 50 mM ammonium bicarbonate containing 0.01% ProteaseMAX Surfactant (Promega). During rehydration ...
-
bioRxiv - Cancer Biology 2024Quote: ... Authenticity of cell lines was evaluated by detection of ten genetic loci using the GenePrint® 10 System (Promega) and cross referencing to ATCC or internal genetic profiles.
-
bioRxiv - Plant Biology 2019Quote: ... An aliquot containing 4 μg RNA was treated for 45 min with 2 μl of DNase RQ1 (1 μg/μl) at 37 °C (Promega, UK), and purified using an RNAeasy spin column (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... Culture media was then replaced with 50 µL of qNSC/aNSC media containing 1 mM 2DG (2-deoxy-D-Glucose, provided in Glucose Uptake-Glo kit from Promega (J1342)) reagent for 10 minutes in incubator (humidified ...
-
bioRxiv - Cell Biology 2019Quote: ... cat # 129-02541) overnight at 37°C and then diluted 1/2 and digested with 0.9 µg of trypsin (Promega, cat # V5113) for eight hours at 37°C ...
-
bioRxiv - Microbiology 2019Quote: ... gel pieces were dried in a vacuum concentrator and re-swollen with 2 ng/μl trypsin solution (sequencing grade trypsin, Promega, USA) followed by overnight digestion at 37 °C ...
-
bioRxiv - Physiology 2020Quote: ... and single-stranded cDNA was synthesized from each sample (2 μg) with M-MLV reverse transcriptase (#0000113467, Promega Corporation, Fitchburg, WI) and RNase inhibitor (40 U ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Cell viability was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) dye reduction assay as described previously [20] or by CellTiterGlo assay (Promega, Walldorf, Germany) following the manufacturer’s instructions after 120h incubation.
-
bioRxiv - Immunology 2021Quote: ... Products were isolated from a 2% agarose gel using the Wizard1 SV Gel and PCR Clean-Up System (Promega, Mannheim, Germany). DNA concentration was determined via the Qubit1 1.0 Fluorometer (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: We performed the apoptosis analysis of the MPro stable cells and cells transiently transfected with the pLVX-MPro-eGFP-2 plasmid using the RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay kit from Promega. The cells were maintained in high glucose DMEM medium supplemented with 10% FBS ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Real-Time PCR Diagnostic Panel17 and a protocol for quantifying the SARS-CoV-2 subgenomic E gene RNA (E SgRNA)18 using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-CoV-2 using the nCoV assay ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Real-Time PCR Diagnostic Panel17 and a protocol for quantifying the SARS-CoV-2 subgenomic E gene RNA (E SgRNA)18 using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-CoV-2 using the nCoV assay ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Biochemistry 2021Quote: ... on-bead digestions were done with 2 µg LysC (Wako chemicals 125-05061) in 4 M urea and 4 µg trypsin (Promega ADV5113) in 1.2 M urea sequentially before quenching with 1% formic acid ...
-
bioRxiv - Biochemistry 2021Quote: ... and the “on-bead-digestion” plate (100 μl 20 mM Tris pH 8.5, Sigma-Aldrich 10708976001, 1 μg/mL LysC, Wako 129-02541, 2 μg/mL Trypsin, Promega V5111). The programmed sequence is ...