Labshake search
Citations for Promega :
1251 - 1300 of 4040 citations for trans 6 Chloro 1 hexen 1 ylboronic acid pinacol ester 96% since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... containing trypsin (Promega; final 1/100 enzyme/protein ratio) and LysC (Wako ...
-
bioRxiv - Cell Biology 2024Quote: ... for 3 h and with trypsin (1:25, Promega) for 16 h both at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... For trypsin digestion 1 μg of trypsin (V5111; Promega) was added ...
-
bioRxiv - Neuroscience 2024Quote: ... then digested with trypsin (Promega, 1:50 w/w) overnight at 37ºC ...
-
bioRxiv - Systems Biology 2024Quote: ... Then 1 µg of sequencing grade modified trypsin (Promega) was added to the samples and incubated for 16 h at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mg/mL Proteinase K (Promega Corporation, WI, USA) with 0.5% SDS in PBS at 40 °C overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL of HaloTag TMR ligand (Promega, 5 mM) was added to 100 µL of JetABC (2.5 µM d-o-p ...
-
bioRxiv - Immunology 2023Quote: ... in a 1.5:1 ratio with FuGene (#E2311, Promega). One day post transfection ...
-
bioRxiv - Biochemistry 2022Quote: ... and 1 μG of sequencing grade trypsin (Promega, V5111) was added for 18 h at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-β-galactosidase (1:1,000, Promega, Cat#: Z3781), rabbit anti-β-galactosidase (1:5,000 ...
-
bioRxiv - Microbiology 2022Quote: ... with 1:500 Enduren luciferase substrate (Promega, Madison, WI) added ...
-
bioRxiv - Biochemistry 2022Quote: ... proteins were digested with 1) chymotrypsin (Promega, Madison, USA), 2 ...
-
bioRxiv - Microbiology 2022Quote: ... and 120 μL 30 mg mL-1 lysozyme (Promega), followed by 30 min incubation at 35 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... and goat anti-mouse IgG (1:5,000; W4011, Promega) antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... Anti-p-JNK (pTPpY, Promega, USA-1:100 dilution); 8 ...
-
bioRxiv - Microbiology 2023Quote: ... using SYBR Green GoTaq 1-Step RT-qPCR (Promega) with the SARS-CoV-2 CDC N3 primers (F – GGGAGCCTTGAATACACCAAAA ...
-
bioRxiv - Bioengineering 2023Quote: ... 1 μL random primers (50 ng/μL, Promega, C1181), 2 μL 0.1 M DTT ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were dyed with 1 – 10 pM JF549 (Promega) and 50 nM Hoechst 33342 for an hour ...
-
bioRxiv - Neuroscience 2024Quote: ... then digested with trypsin (Promega, 1:50 w/w) overnight at 37°C ...
-
bioRxiv - Plant Biology 2024Quote: ... leaves were sprayed with 1 mM D-luciferin (Promega) and incubated in dark for 10 min ...
-
bioRxiv - Neuroscience 2024Quote: ... and digested with Trypsin (1:50, Promega, Cat # V5280) for overnight incubation at 37°C with intensive agitation ...
-
bioRxiv - Neuroscience 2024Quote: ... Secondary antibodies: anti-mouse-IgG (Promega, W4028, 1:2500) and anti-rabbit-IgG (Promega ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 unit of RNase inhibitor (Promega, cat ID# N251B) and micrococcal nuclease (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 1% Nluc substrate (Nano-Glo, Promega, Madison, USA) in the presence of release factors (50 nM of eRF1 alone ...
-
bioRxiv - Microbiology 2024Quote: ... and 120 μL 30 mg mL−1 lysozyme (Promega), and 30 min incubation at 35 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 µL of HiBit buffer (LgBit 1:200, Promega, N112A ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-GFAP (1:1000; Promega, Cat. No. G560A), rabbit anti-GPX4 (1:1000 ...
-
bioRxiv - Immunology 2024Quote: ... and RNasin® Ribonuclease Inhibitor (#N2615, Promega; 1:1000)) ...
-
bioRxiv - Microbiology 2024Quote: ... leaves were sprayed with 1□mM luciferin (Promega, E1603) and 0.02 % (v/v ...
-
bioRxiv - Neuroscience 2024Quote: ... and digested with Trypsin (1:50, Promega, Cat # V5280) for overnight incubation at 37°C with intensive agitation ...
-
bioRxiv - Microbiology 2024Quote: ... 1 ng of a reference plasmid pGL3 (Promega U47296) was spiked into the DNA samples prior to loading on to the spin columns to normalize DNA elution efficiency.
-
bioRxiv - Biophysics 2024Quote: ... to which 1 uM HaloTag TMR ligand (Promega, G825A) was supplied for 30 minutes ...
-
bioRxiv - Systems Biology 2024Quote: ... 100 µl of 1:50 Furimazine:NanoGlow (Promega, Southampton UK) were added using a multipipette ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and a 1:100 dilution of LgBiT protein (Promega) was added to each well ...
-
bioRxiv - Biochemistry 2024Quote: ... and 1 μL of 10 mM dNTP (Promega, U1515) solutions were added to the mixture ...
-
bioRxiv - Cell Biology 2024Quote: ... An additional volume of LysC (Promega, 1:100 ratio) was added for ∼3 hours before acidifying to pH 3-4 with 10% formic acid ...
-
bioRxiv - Cell Biology 2024Quote: ... 1% Triton-X100) supplemented with RNasin Plus inhibitor (Promega) and HALT phosphatase and protease inhibitors (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1 μl M-MLV-RT enzyme (M1701, Promega). PCR was performed in a 20 μl vol ume containing 10 pmol of each primer ...
-
bioRxiv - Developmental Biology 2024Quote: ... cells were treated with 1 μM HaloPROTAC3 (Promega GA3110) or DMSO as control ...
-
bioRxiv - Plant Biology 2021Quote: The optimised HaloTag®-7 sequence (298 amino acids) from Promega (https://www.promega.de/) was genetically split on position 155/156 aa into the N-terminal fragment “NHalo” (aa 1-155 ...
-
bioRxiv - Developmental Biology 2023Quote: ... followed by DNA staining with Diamond™ Nucleic Acid Dye (Promega, Madison, WI)
-
bioRxiv - Molecular Biology 2024Quote: ... and 10 μl of premix [100 μM amino acid mixture without methionine (Promega), 100 μM amino acid mixture without leucine (Promega) ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was purified according to manufacturer instructions using phenol:chloroform nucleic acid extraction (Promega).
-
bioRxiv - Microbiology 2024Quote: ... or Maxwell 16 Viral Total Nucleic Acid Purification Kit (Promega Corporation, Madison, USA) for viral detection in cell culture supernatant ...
-
bioRxiv - Systems Biology 2020Quote: ... TFE was then diluted to 25% with 50mM ABC, LysC (Wako Chemicals, 1:100 lysC:protein ratio) and sequencing-grade modified trypsin (Promega, 1:50 trypsin:protein ratio) was added and incubated overnight at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... TFE was then diluted to 25% with 50 mM ABC, LysC (Wako Chemicals, 1:100 lysC:protein ratio) and sequencing-grade modified trypsin (Promega, 1:50 trypsin:protein ratio) was added and incubated overnight at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... protein digestion was performed by 1 µg of Lys-C (Wako) at 37 °C for 3 h following 1 µg of trypsin (Promega, Madison, WI, USA) at 37 °C for 16 h ...
-
bioRxiv - Cell Biology 2022Quote: ... The samples were then diluted to a final guanidine chloride concentration of 1 M with 100 mM ammonium bicarbonate and digested with sequencing grade porcine trypsin (Promega, 1:100 trypsin:protein) for 22 h at 37° C ...
-
bioRxiv - Immunology 2020Quote: Activity of the inflammatory caspases 1/4/5 was measured using a commercially available Caspase-Glo® 1 Inflammasome Assay (Promega, WI, USA) from HFFs seeded in 96-well plates (2×104 cells per well) ...
-
bioRxiv - Molecular Biology 2023Quote: ... or stimulated for 10 minutes or 1 hour by BRET through activation of NanoLuc’s bioluminescence with its substrate furimazine (1:100 dilution of Promega nano-Glo Live Assay). After treatment ...