Labshake search
Citations for Promega :
1051 - 1100 of 1323 citations for Rh Family C Glycoprotein RHCG Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... and alkylation treatment (100 mM iodoacetamide / 45 min incubation at room temperature) were followed by 16 hr incubation at 37°C with sequencing grade trypsin (Promega, Madison WI). Tryptic peptides were acidified with formic acid ...
-
bioRxiv - Physiology 2022Quote: ... protein samples were digested by incubated overnight at 37°C with sequencing-grade modified trypsin (1/50, w/w; Promega, Madison, Wisconsin). Samples were acidified using 5% TFA and peptides cleaned up using the Phoenix 96× kit (PreOmics ...
-
bioRxiv - Molecular Biology 2022Quote: ... Pelleted cells were disrupted by glass beads agitation at 4°C in 1x Passive Lysis Buffer provided in the Dual-Luciferase® Reporter Assay System (Promega, #E1910). Extracts were clarified by centrifugation ...
-
bioRxiv - Zoology 2022Quote: ... The mixture was diluted with 150 μL of 50 mM Tris-HCl pH8.0 and digested by adding 500 ng Trypsin/Lys-C mix (Promega, Madison, WI, USA) overnight at 37 °C ...
-
bioRxiv - Systems Biology 2022Quote: ... 102.2 µL of 100 mM TEAB was added and proteins were digested for 16 hours at 37°C using 5 µg of trypsin (dissolved in trypsin resuspension buffer, Promega, Walldorf, Germany). Tryptic digestion was stopped by addition of 2.5 µL 100% formic acid ...
-
bioRxiv - Microbiology 2022Quote: Genomic DNA was extracted at the NCPHL from subcultures inoculated with single bacterial colonies and grown in nutrient agar (Oxoid, USA) at 37°C overnight according to the manufacturer instructions (Wizard® Genomic DNA Purification kit, Promega, UK). Genomic DNA samples (derived from 10 environmental and 250 clinical samples ...
-
bioRxiv - Molecular Biology 2024Quote: ... The clear supernatant was incubated overnight at 4°C with 100 μl of prewashed Magne® HaloTag® Beads (Promega, WI, USA). Post-incubation ...
-
bioRxiv - Microbiology 2024Quote: ... culture supernatants were frozen at −s80°C and macrophages were processed according to the Promega E1500 Luciferase Assay System protocol (Promega, Madison, WI). Cells were lysed and incubated with D-Luciferin substrate for 5 min in white Lumitrac™ plates (Greiner Bio-one ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was synthesized with primers specific for each strand separately at 50 °C (Supplemental Table S1) using the ImProm-II™ Reverse Transcription System (Promega, A3800) and subjected to qPCR with primers specific for the viral N-protein (Supplemental Table S1).
-
bioRxiv - Systems Biology 2023Quote: ... and the bound proteins were subjected to on-cartridge digestion with mass spec grade Trypsin/Lys-C Rapid digestion enzyme (Promega, Madison, WI) at 70°C for 2h ...
-
bioRxiv - Biochemistry 2023Quote: One-hundred microliters of 50 mM Tris-HCl (pH 8.0) and 500 ng of trypsin/Lys-C mix (Promega, cat. no. V5072) were added to the washed HaloTag ligand plate following the first-generation assay and mixed gently at 37 °C overnight to digest the proteins ...
-
bioRxiv - Cancer Biology 2024Quote: ... tissues were incubated with primary antibodies diluted in 10% DS in PB1 for 3 days at 4°C followed by four washes over the following day with 0.2% Tween-20 (Promega UK Ltd, H5151) in PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... As secondary antibodies we used horseradish peroxidase coupled anti-mouse (Promega W402B), anti-rabbit (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... Immune complexes were detected with anti-rabbit peroxidase-conjugated secondary antibodies (Promega) and enhanced chemiluminescence reagents (Pierce ...
-
bioRxiv - Developmental Biology 2021Quote: ... The primary antibodies used are mouse β-Gal (1:250; Promega #Z3781), mouse anti-Wingless (1:100 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 200 μL of rabbit polyclonal antibody against PLRV-CP (1:5000; Promega) was added to each well and incubated for 3 h at 37 °C ...
-
bioRxiv - Biophysics 2019Quote: ... the horseradish peroxidase-conjugated goat anti-mouse IgG secondary antibody (Promega, W4021) and a Goat anti-Rabbit IgG (H&L) ...
-
bioRxiv - Immunology 2019Quote: ... HRP-conjugated antibodies (anti-mouse or anti-rabbit IgG HRP conjugate, Promega) were detected by enhanced chemiluminescence detections (Thermofisher ...
-
bioRxiv - Microbiology 2021Quote: ... Secondary antibodies used in Western blotting were conjugated to alkaline phosphatase (Promega) or horseradish peroxidase.
-
bioRxiv - Microbiology 2020Quote: ... Secondary HRP conjugated goat anti-mouse IgG antibodies (Promega, Madison, WI; W4021) was used at 1:50,000.
-
bioRxiv - Cell Biology 2022Quote: ... Secondary antibodies conjugated to horseradish peroxidase (1:10,000, W401B and W402B, Promega) were applied in the same solution for one hour at room temperature before activity was detected (SuperSignal West Pico PLUS 34580 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the goat anti-rabbit antibody (anti-rabbit IgG AP conjugate, Promega) as secondary antibody (30) ...
-
bioRxiv - Genetics 2021Quote: ... the following antibodies were used: mouse anti-beta-galactosidase (Promega; 1:100), mouse anti-Mmp1 (1:1:1 mixture of DSHB 3A6B4 ...
-
bioRxiv - Developmental Biology 2024Quote: ... the membrane was incubated in secondary antibody conjugated to horseradish peroxidase (Promega) at a dilution of 1:5000 for 1h at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by HRP-conjugated secondary anti-mouse antibody (1:5000, Promega W402B), diluted as indicated ...
-
bioRxiv - Microbiology 2023Quote: ... Secondary antibodies used in Western blotting were conjugated to alkaline phosphatase (Promega) or horseradish peroxidase.
-
bioRxiv - Microbiology 2023Quote: ... followed by horseradish peroxidase-conjugated (HRP) secondary rabbit antibodies (Promega, 1/25000) and revealed by chemiluminescence (Pierce ...
-
bioRxiv - Biochemistry 2022Quote: ... membrane was incubated with anti-HaloTag antibody (1:1000; Promega Corporation; G9281) and then with anti-Rabbit IgG Horseradish Peroxidase linked whole antibody (1:5000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antibody signal was detected using the ECL Western Blotting Substrate (W1015, Promega) and X-ray film (F-BX810 ...
-
bioRxiv - Genetics 2023Quote: ... Secondary horseradish peroxidase-conjugated anti-mouse or anti-rabbit IgG antibodies (Promega) were used at 1 ...
-
bioRxiv - Neuroscience 2023Quote: ... The immunoblots were probed with appropriate secondary antibodies (Promega and Li-Cor) and visualised by chemiluminescence (Supersignal detection kit ...
-
bioRxiv - Biochemistry 2023Quote: ... Secondary antibodies used were: anti-rabbit-IgG-HRP (W401B, 1:8000, Promega); anti-mouse-IgG-HRP (W402B ...
-
bioRxiv - Cell Biology 2024Quote: ... proteins were detected with secondary peroxidase-conjugated antibodies (Promega, Madison, WI, USA) and ECL ...
-
bioRxiv - Molecular Biology 2024Quote: ... secondary antibodies: anti-rabbit HRP or anti-mouse HRP (Promega, 1:10000).
-
bioRxiv - Microbiology 2020Quote: ... plates were incubated at 37°C for 72 hours prior to assessing luciferase activity using the Renilla-Glo Luciferase Assay System (Promega, Madison, WI, USA). Readout of eGFP was done by incubating and monitoring plates at 37°C for 72h in an IncuCyte® (Essen BioScience Inc. ...
-
bioRxiv - Microbiology 2022Quote: Genomic DNA was prepared from a single colony cultured overnight at 37°C in LB using the Maxwell 16 system (Promega Corp., Madison, WI). Libraries for Illumina sequencing were prepared using either Nextera XT (Illumina ...
-
bioRxiv - Plant Biology 2020Quote: ... approximately 0.6 mg IgG-enriched proteins were first digested on the beads with mass spectrometry-grade Trypsin/Lys- C Mix (Promega, Madison, WI, USA) at a 1:50 (enzyme/substrate ...
-
bioRxiv - Microbiology 2019Quote: ... Samples were then diluted 4-fold with 100 mM Tris HCl pH 8.5 to reach a concentration of 2M urea and then re-incubated overnight at 37°C with 1 µg Sequencing Grade Modified Trypsin (Promega, Madison, WI, USA). A second incubation with the same amount of trypsin (5 h at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... for 20 min at 56°C before DNA was purified with Maxwell® RSC Blood DNA Kit (Promega Pte. Ltd., Cat. No. AS1400). DNA concentration was quantified using Qubit® 2.0 fluorometer ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pellets were reconstituted and digested with endoproteinase Lys-C (Alpha Laboratories, UK) for 1 hour at room temperature and trypsin (Promega, Madison, WI, USA) overnight at 35°C.
-
bioRxiv - Cancer Biology 2020Quote: ... The lysate obtained from each tumour sample was mixed at 1:1 ratio with the super-SILAC standard prior to FASP digestion41 with Endoproteinase Lys-C (Alpha Laboratories, UK) and trypsin (Promega, Madison, WI, USA).
-
bioRxiv - Immunology 2022Quote: ... and the RNA was precipitated with an equivalent volume of isopropanol and incubated at 55°C for 10 minutes before being resuspended in 50 μL of RNase-free water (Promega, Madison, WI, USA). We determined the concentrations of RNA using a Smart-Spec plus spectrophotometer (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: ... collected by centrifugation (17,000 g for 10 min at 4°C) and solubilized in 20 μl 50 mM TEAB containing 0.2 % ProteaseMAXTM Surfactant (Promega UK Ltd, Cat. # V2071) for 1-2 h with vortex and occasional sonication ...
-
bioRxiv - Molecular Biology 2021Quote: ... The transfected cells were cultured at 37°C for 36 h and subjected to luciferase activity analysis using the Dual-Glo Luciferase Assay System (Promega, Madison, WI, USA).
-
bioRxiv - Cell Biology 2019Quote: ... containing T7 promoter at the 5’ end at 37 °C using the T7 RiboMax Express Large-Scale RNA Production System (Promega Corp., Madison, WI), following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... Tryptic samples were subsequently diluted to 2M urea in 100mM Tris/HCl pH 8 and digested over night at 37°C (Promega, enzyme:protein 1:100). Samples were adjusted to pH 2 using 10% trifluoroacetic acid (TFA ...
-
bioRxiv - Immunology 2021Quote: ... CDC was measured after incubation for 3 hours at 37 °C 5% CO2 with a luminometer using the CytoTox-Glo Cytotoxicity Assay (Promega; Cat. Nr.: G9291) according to the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2022Quote: ... They were later subjected to reverse transcription for 45 min at 37°C with 200 U of reverse transcriptase M-MLV (Promega, Madison, WI, USA) in the appropriate buffer.
-
bioRxiv - Neuroscience 2022Quote: ... and 30 s extension at 72 °C using the specific primers (Forward: CCACGCAACACACAGTCAAG, Reverse: GCAAGTTACTTTGCAGAGGTC) and GoTaq G2 DNA polymerase (Promega, Madison, Wisconsin, USA). Each PCR mixture (15 μl ...
-
bioRxiv - Cell Biology 2023Quote: ... 35S-methionine-labeled Ctb or its derivatives were produced in coupled in vitro transcription and translation reaction (IVTT, at 30 °C for 1 h) using TNT Quick Coupled Transcription/Translation System (cat#L1170, Promega, Madison, WI, USA). Prey proteins were diluted in binding buffer (50 mM HEPES pH 7.5 ...