Labshake search
Citations for Promega :
1051 - 1100 of 4810 citations for 7 hydroxy 1H 1 2 4 triazolo 1 5 a pyrimidin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... and rehydrated with 5 μL of digestion solution containing 20 mM ammonium bicarbonate and 15 ng/μL sequencing grade trypsin (Promega). Digestion was carried out at 37°C for 6 h ...
-
bioRxiv - Microbiology 2021Quote: ... primer TTC CGC AAG TTC ACC TAC C and the reverse (3’ – 5’) primer CGG GCC GGC CAT GCT TTA CG with GoTaq Flexi DNA polymerase (Promega) and the following cycling conditions ...
-
bioRxiv - Cell Biology 2020Quote: ... and the proteins were on-bead digested using 5 µl of Sequencing Grade Trypsin (100 ng/µl in 10 mM HCl, Promega). The digestion was carried out at 37°C over night ...
-
bioRxiv - Microbiology 2021Quote: ... where the multiple cloning site had been replaced by a synthetic construct (Genewiz) composed of a 5’ HiBiT tag (Promega), a new multiple cloning site and 3’ 3xHA tag ...
-
bioRxiv - Cancer Biology 2021Quote: ... 293T cells were transfected with 8xTEAD synthetic YAP/TAZ-responsive promoter-luciferase reporter and treated with BSA or recombinant TNC (5 µg/mL) for 48 h to measure YAP1 signaling activity using Dual-luciferase Reporter Assay Kit (Promega).
-
bioRxiv - Immunology 2021Quote: ... Wells were then washed 5 times with wash buffer and the remaining bound cells were detected with the CellTiterGlo kit (Promega) as per the manufacturer’s instructions.
-
bioRxiv - Systems Biology 2022Quote: ... and 72h in 3-5 wells for each condition (mean values of 3-5 technical replicates are provided for each donor) using a multiwell plate reader Glomax (Promega). Each 2h incubation was performed at a multiplicity of infection (MOI ...
-
bioRxiv - Microbiology 2022Quote: ... was added to the plate and incubated at room temperature for 5 min before measuring luminescence on a GloMax 96 luminometer (Promega).
-
bioRxiv - Immunology 2022Quote: ... for 48 hours after which cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... was added to a final concentration of 3 mM followed by the addition of 5 µl of T7 Enzyme Mix and 50 U RNasin RNase Inhibitor (Promega). To produce transcripts for mock transfections the GTP concentration was increased to 7.5 mM and cap analogues were not added ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... total RNA was extracted separately from two 5 mg crushed-tissue samples by using the SV Total RNA Isolation System (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... in vitro translated hnRNP M protein fragments (5 μl) produced by rabbit reticulocyte lysate using TNT Quick Coupled Transcription/Translation Systems (Promega). Proteins were incubated at 4°C for 2 hours in the binding buffer above ...
-
bioRxiv - Biochemistry 2019Quote: A commercial K562 cell digest supplemented with the 6 x 5 LC-MS/MS Peptide Reference Mix (QC4Life Reference Standard, Promega) was used as quality control (QC ...
-
bioRxiv - Developmental Biology 2019Quote: ... Stellaris® DNA probes were gently resuspended in 95 µl fresh TE buffer and 5 ul RNAse inhibitor (RNAsin Plus RNase Inhibitor, Promega), and frozen at −80 °C in 10 µl aliquots ...
-
bioRxiv - Bioengineering 2019Quote: ... and 8-oxo-2’-deoxyguanosine-5’-triphosphate (8-oxo-dGTP) respectively,52 both in combination with the non-proofreading Taq DNA polymerase (GoTaq, Promega). The primers used for this PCR reaction anneal outside the His6-SpAS1 open reading frame (Table S8) ...
-
bioRxiv - Genetics 2020Quote: ... double-stranded DNA oligos containing KRAB-ZFP target sequences (Supplemental Table 5) were cloned upstream of the SV40 promoter of the pGL3-Promoter vector (Promega) between the restriction sites for NheI and XhoI ...
-
bioRxiv - Synthetic Biology 2020Quote: ... were grown in 5 mL LB medium overnight and plasmid DNA was isolated using the PureYield Plasmid Miniprep System (Promega). The plasmids were further tested by a restriction enzyme digestion analysis ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cells were incubated for 3 days at 35°C with 5% CO2 and cell viability was evaluated using the CellTiter Glo (Promega) post the 3-day incubation ...
-
bioRxiv - Microbiology 2021Quote: ... The V4 region of the 16S rRNA gene was amplified using the universal primers 515F (5′-GTG CCA GCM GCC GCG GTA A-3′) and 806R (5′-GGA CTA CNN GGG TAT CTA AT-3′) [26] with Taq&Load MasterMix (Promega). PCR reactions ...
-
bioRxiv - Microbiology 2019Quote: High-molecular weight genomic DNA of bacteria was isolated from 5 mL overnight cultures using the Wizard genomic DNA isolation kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... at pH 8 and subjected to reductive alkylation (using 15 mM iodoacetamide and 5 mM DTT) and methanol/chloroform extraction followed by digestion with sequencing-grade Trypsin (Promega) overnight at 37°C.Tryptic peptides were desalted and analyzed by liquid chromatography tandem mass spectrometry (LC-MS/MS ...
-
bioRxiv - Developmental Biology 2019Quote: ... cells into micro-tubes containing 5 µl of cold 1X SuperScript IV VILO Master Mix for two-step RT-qPCR containing 6 units RNasin (Promega) and 0.5% (v/v ...
-
bioRxiv - Immunology 2021Quote: ... The mixture was subsequently incubated with 293TAce2 cells for 48 h after which cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Plant Biology 2021Quote: ... For SlTPD1 a 284 bp DNA fragment from the 5’ coding region was amplified by PCR using cDNA from flowers and cloned into the pGEM-T Easy vector (Promega). For TomA5B and SlSDS genes ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was isolated from approximately 5×105 cells using the ReliaPrepTM RNA Cell Miniprep System (Promega, UK, Cat. Z6012) following product guidelines ...
-
bioRxiv - Immunology 2020Quote: ... At 48 h later the cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Immunology 2021Quote: ... extensively washed to remove unbound virus and co-cultured with Huh7.5 for 5 days at 37°C after which they were analyzed for with the Luciferase assay system (Promega, USA) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... that introduced a 5’ KpnI site and a 3’ XhoI site and cloned into the pGL3 firefly luciferase vector (Promega). Site directed mutagenesis was performed as described above ...
-
bioRxiv - Microbiology 2022Quote: ... Huh7.5.1 cells were infected with MLB1 and MLB2 astroviruses (MOI 5) in the presence or absence of 20 µM z-VAD-fmk (pan-caspase inhibitor, Promega). At indicated time post infection ...
-
bioRxiv - Developmental Biology 2022Quote: ... Proteins were on-bead digested using 5 μl of Sequencing Grade Trypsin (100 ng/μl in 10 mM HCl, Promega). The digestion was carried out in a microwave instrument (Discover System ...
-
bioRxiv - Molecular Biology 2022Quote: ... from the EPO gene enhancer (sequence: tcgaagccctacgtgctgtctcacacagcctgtctgacctctcgacctaccggccgttcgaagccctacgtgctgtctcacacagccttct gatctcgacctaccggccgttcgaagccctacgtgctgtctcacacagcctgtctgacctctcgacctaccggccgt) into the 5’ of the minimal TATA-box promoter in the pGL4.23 [luc2/minP] vector (Promega #E841A). A control pHRL-TK vector (Promega #E2241 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Flies were placed individually in 100 ul Chelex solution (5g of Chelex mixed with 95ml TE buffer) with 5 ul proteinase K (Promega), and incubated overnight at 56°C ...
-
bioRxiv - Immunology 2022Quote: ... or HT1080/Ace2 cl14 cells (for all variant neutralization assays) for 48 hours after which cells were washed with PBS and lysedwith Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysateswas measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Plant Biology 2022Quote: ... primer extension products reverse-transcribed with a gene-specific primer (reverse-complementary to the 16S rRNA nucleotides 1092-1108; 5’-CAGTCTGTTCAGGGTTC-3’) and AMV reverse transcriptase (Promega) were analyzed by qPCR with the primer pairs ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Kinase activity of phosphorylated CDK2 with cyclin A and varying amounts of inhibitor (dinaciclib or 5) were measured using the ADP-Glo Kinase Assay (Promega) in a luminescence plate reader (Tecan Infinite M1000 PRO) ...
-
bioRxiv - Neuroscience 2022Quote: ... Flag-tagged STAU1 or STAU1RBDΔ3 or Flag plasmids with the wildtype or mutant 5’UTR-MTOR-LUC or luciferase empty vector constructs and Renilla luciferase plasmid (pRL-SV40 vector, Promega) according to an experimental set-up ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mM MgCl2, 1.5 mM KCl, 100 μ g/ml cycloheximide, 1mM DTT, 200 U/ml RNase in from Promega, 0.5% Sodiumdeoxycholate ...
-
bioRxiv - Plant Biology 2022Quote: ... Protein precipitates were resolubilized in 5% trifluoroethanol of aqueous 100 mM TEAB and digested overnight (18 hours) with a Trypsin+LysC mixture (Promega) at a protein to protease ratio of 25:1 ...
-
bioRxiv - Microbiology 2022Quote: ... and alkylated with 5 mM of iodoacetamide 30 min in the dark at RT°C prior to digestion with 5 μg of trypsin Gold (Promega) for 15 h at 37 °C ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were pelleted (2000 g x 5 min) and subjected to genomic DNA (gDNA) extraction using the Wizard Genomic DNA Purification kit (Promega), according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2022Quote: ... 100 μL of Nano-Glo HiBiT Lytic Detection Reagent was added directly to the cells and incubated for 5 min on an orbital shaker (300 rpm) before recording luminescence on a GloMax Discover (Promega) with 0.2 s integration time.
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were maintained at 37 °C and 5% CO2.Cell lines were authenticated using Short Tandem Repeat fingerprinting carried out using the GenePrint 10 system (Promega). For 3D spheroids ...
-
bioRxiv - Microbiology 2023Quote: ... and genomic DNA was isolated from overnight cultures (5 mL) using the Wizard Genomic DNA Purification Kit (Promega GmbH, Walldorf) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... a pPolI-Firefly plasmid encoding the Firefly luciferase sequence in negative polarity flanked by the 5’ and 3’ non-coding regions of the IAV NS segment was used and the pTK-Renilla plasmid (Promega) was used as an internal control ...
-
bioRxiv - Microbiology 2023Quote: The RNase III.RNA complexes were washed and the 5′ ends of bound RNAs were dephosphorylated with the addition of thermosensitive alkaline phosphatase (Promega). RNA was radiolabelled by phosphorylation with T4 PNK (Sigma-aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... 56 °C for 30 seconds and 72 °C for 30 seconds (30 cycles) and 72 °C for 5 minutes using GoTaq DNA polymerase (Promega) and a forward primer (hChimera exon 1-F ...
-
bioRxiv - Microbiology 2023Quote: ... were made by replacing the ORF3 region encoding 5–105 amino acids with an in-frame insertion downstream of 4th VP2 codon sequence of UnaG and NanoLuc (Promega) coding regions with their own stop codons ...
-
bioRxiv - Neuroscience 2023Quote: Surface expression was measured using a HiBit-tagged 5-HT2A receptor and the Nano-Glo HiBit Extracellular Detection System (Promega). N-terminal HiBit-tagged human 5-HT2A receptor was cloned into pcDNA3.1 using Gibson Assembly ...
-
bioRxiv - Microbiology 2023Quote: ... 5% CO2 before measurement of Renilla and Firefly luciferase activities using Dual-Glo® Luciferase Assay System (Promega, Cat #E2920) and Tecan SPARK plate reader ...
-
bioRxiv - Biochemistry 2023Quote: ... dehydrated with 0.2 mL of 100% acetonitrile and rehydrated with 5 μL of the digestion solution containing 15 μg/mL sequencing-grade trypsin (Promega) in 20 mM aqueous solution of NH4HCO3 ...