Labshake search
Citations for Promega :
951 - 1000 of 5099 citations for 7 hydroxy 1H 1 2 4 triazolo 1 5 a pyrimidin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... The reaction was stopped with the addition of 150 µL IP Elution Buffer (1% SDS, 0.1 M NaHCO3) and 2 µL Proteinase K (Promega, Cat # MC5005), then incubated at 65 °C overnight to reverse crosslinks ...
-
bioRxiv - Developmental Biology 2023Quote: ... Membranes were washed in TBST and probed with anti-mouse HRP secondary antibody (Promega; 1:5000 in 2% BSA in TBST) for 1 h at room temperature followed by development in ECL (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: The viral RNA derived from the lung and nasal turbinate samples was quantified using a protocol for quantifying the SARS-CoV-2 sub-genomic E gene RNA (sgE)29 using the GoTaq® Probe 1-Step RT-qPCR System (Promega).
-
bioRxiv - Microbiology 2020Quote: ... Urea was reduced to 1 M by addition of 500 μl AB and overnight digestion was performed at 37 °C with 5 μl of freshly prepared 0.2 μg/μl trypsin (Promega) in AB ...
-
bioRxiv - Molecular Biology 2020Quote: ... The samples were then diluted to 2 M urea final concentration via the addition of 20 mM HEPES pH 8.0 and digested overnight with 5 µg/ml sequence-modified trypsin (Promega) at room temperature.
-
bioRxiv - Microbiology 2020Quote: ... venezuelae macrocolonies that were grown for 30 h at 30°C on MYM agar were pooled and resuspended in 200 µl ice-cold stop solution (5% phenol (pH 4.3) in 98% ethanol) and RNA was isolated using the SV Total RNA Isolation Kit (Promega). After elution ...
-
bioRxiv - Immunology 2019Quote: ... and the pellet was resuspended in 20 mL buffer A (NaPO4 20 mM, NaCl 500 mM and imidazole 20 mM, pH 7,4) containing 5 U of DNAse (Promega) and 30 ug/mL lysozyme (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... for 48h after which cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μL of DNA or 5 μL of cell lysate were mixed with 12.5 μL of GoTaq Colorless Master Mix (Promega), 1 μL of forward and reverse primer (5 μM ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by 5 min quenching with 100 mM glycine and permeabilization with 0.5% Triton X-100 (Promega, Madison, WI) in 1 × PBS for 15 min ...
-
bioRxiv - Microbiology 2020Quote: ... Urea was reduced to 1 M by addition of 500 μl AB and overnight digestion was performed at 37 °C with 5 μl of freshly prepared 0.2 μg/μl trypsin (Promega) in AB ...
-
PPARγ is a tumor suppressor in basal bladder tumors offering new potential therapeutic opportunitiesbioRxiv - Cancer Biology 2019Quote: ... These cells were transfected 24 h later with 2.5 µg of pcDNA3-PPARγ2 (wild-type or mutated) in the presence of the Fugene HD transfection reagent (Promega). PPARγ2 transient overexpression in the UMUC3 ...
-
bioRxiv - Microbiology 2021Quote: ... Urea was reduced to 1 M by addition of 500 ml AB and overnight digestion was performed at 37°C with 5 ml of freshly prepared 0.2 mg/ml trypsin (Promega) in AB ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were incubated at 37°C/5% CO2 for 3 days before performing CellTiter-Glo (CTG) assays as per the manufacturer’s instruction (Promega). Luminescence was read using a Molecular Devices Spectramax L plate reader ...
-
bioRxiv - Cancer Biology 2020Quote: ... Plates were incubated for 72hr at 37°C with 5% CO2 and then measured by CellTiter-Glo assay (Promega). Briefly ...
-
bioRxiv - Biophysics 2021Quote: ... The reaction was incubated at 30 °C for 5 hours and 2.5 µL of the reaction mix was added to 50 µL of luciferase assay reagent (Promega) pre-equilibrated in room temperature ...
-
The spatial landscape of progression and immunoediting in primary melanoma at single cell resolutionbioRxiv - Cancer Biology 2022Quote: ... a second jar of xylene for 5 min then incubated in a series of ice-cold solutions with 0.0025% RNasin Plus (Promega): 100% ethanol for 1 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Liquid was removed and gel pieces were dehydrated in 100% ACN at RT for 5 min at 2,000 rpm followed by rehydration in 100 mM NH4HCO3 containing 14 ng/μL trypsin (Promega) on ice for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... and the PCR products of 5’ RACE were cloned using pGEM®-T Easy Vector Systems (Promega, WI, USA). Purified PCR fragments and pGEM cloning 5’-terminal sequence of BToV were sequenced using primers designed for every ∼300 bp of the BToV genome ...
-
bioRxiv - Microbiology 2021Quote: ... Ten nanograms of template DNA was added to 5 μl Green GoTaq Reaction Mix Buffer (Promega, Madison, Wisconsin, USA), 1.25 units of GoTaq DNA Polymerase (Promega ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were incubated at 37°C and 5% CO2 for 3days before CellTiter-Glo (CTG) assays were performed as per the manufacturer’s instructions (Promega). Luminescence was read using a Molecular Devices SpectraMax L plate reader.
-
bioRxiv - Plant Biology 2019Quote: ... PCR amplifications were carried out in a total reaction volume of 10μL containing 5 μL of 2xGoTaq master mix (Promega) and 2.5 μL of 4M betaine ...
-
bioRxiv - Plant Biology 2020Quote: ... proteins were precipitated overnight with 5 volumes of cold 0.1 M ammonium acetate in 100% methanol and digested with sequencing-grade trypsin (Promega) and each sample was analyzed by nanoLC-MS/MS on a QExactive+ mass spectrometer coupled to an EASY-nanoLC-1000 (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2020Quote: ... in DEPC-treated phosphate buffer (PB) with 0.5% Triton X-100 supplemented with RNasin (40Ul/µl stock, 5 ml/ml of buffer, Promega). We rinsed sections ...
-
bioRxiv - Microbiology 2021Quote: ... seriolae gDNA was extracted from 5-day old cultures using the Wizard® Genomic DNA Purification Kit (Promega, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... HEK cells were transfected with 5’UTR-reporters for 24h using ViaFect reagent according to the manufacturer’s protocol (Promega). Next ...
-
bioRxiv - Immunology 2021Quote: ... Luminescence was measured after 20 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).
-
bioRxiv - Immunology 2021Quote: ... Luminescence was measured after 20 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).
-
bioRxiv - Immunology 2022Quote: ... Luminescence was measured after 22 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).
-
bioRxiv - Cancer Biology 2024Quote: ... a multiplexed caspase/viability assay was performed as described before [5] using the Multiplex Assay ApoLive-Glo (Promega, G6411) kit.
-
bioRxiv - Molecular Biology 2024Quote: ... 400 μl cold cell lysis buffer (20 mM HEPES, pH 7.4, 100 mM KCl, 5 mM, MgCl2, 500U/ml RNasin-Plus (Promega), 1x protease inhibitor cocktail (200X ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the equivalent region in the human (−207/+5) were cloned into pGL3-basic Luciferase reporter-vector (E1751, Promega) using the forward primer containing XhoI restriction site ...
-
bioRxiv - Systems Biology 2023Quote: ... cooled on ice to room temperature for 5 min and digested overnight at 37 °C with 0.5 μg of sequencing-grade trypsin (Promega). Peptide mixtures were acidified to pH 3 with 1.5 µl 5% FA ...
-
bioRxiv - Molecular Biology 2023Quote: ... After incubation at 37 °C/5 % CO2 for 20 h 40 nl HaloTag® NanoBRET™ 618 Ligand (PROMEGA) was added to the cells using an Echo acoustic dispenser (Labcyte ...
-
bioRxiv - Cell Biology 2023Quote: ... About 5 µg of the purified mRNA was used to generate cDNA using the Go script kit (Promega #A5001). The KRAS coding region was amplified using a pair of primers Kras_Exon1-F (5’ CCGCCATTTCGGACTGGGAGCGAGCGC 3’ ...
-
bioRxiv - Immunology 2023Quote: ... Luminescence was measured after 22 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).
-
bioRxiv - Cancer Biology 2022Quote: ... DNA from My-La cells was amplified by use of primers GATA3_AICE_KpnI s 5’-GCGGTACCATACAGACCCTTCCAGCCAC and GATA3_AICE_XhoI as 5’-GCCTCGAGAACAGATGTGGGGAGTCAGA and cloned via KpnI and XhoI into the multiple cloning site (MCS) of pGL3 (Promega). All constructs were verified by sequencing.
-
bioRxiv - Immunology 2023Quote: Promoter constructs were created by cloning the immediate 4.5-kb region adjacent to the 5’ TSS of SPINK7 into the promoterless Nano-luciferase reporter vector pNL1.1-NL (Promega). The 4.5-kb sequence and subsequent constructs were created by using primers with the restriction enzyme sites KpnI-HF and XhoI ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 5 µL of the supernatant were diluted in 45 µL of Luciferase Assay Reagent (Luciferase Assay System, E1500, Promega) and measured at a Synergy HT reader (BioTek ...
-
bioRxiv - Cancer Biology 2023Quote: ... beads were reconstituted in 5 μL 50 mM HEPES pH 8.0 buffer containing trypsin/rLys-C enzyme mix (Promega) at a 1:25 enzyme to protein ratio ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... using primers listed in Supplementary Table 5 and products cloned using the pGEM-T Easy Vector System I (Promega) or Phusion HF DNA polymerase (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... The coding sequence of NanoLuc was amplified by PCR using the primers 5-NanoL and 3-NanoL from pNL1.1.CMV plasmid (Promega). The resulting fragment was digested with BamHI and NotI enzymes and cloned into pEGFP-N1 digested with the same enzymes ...
-
bioRxiv - Neuroscience 2024Quote: ... Transfection was performed at ∼5 DIV after half-replacing the medium with fresh proliferation medium using Fugene 6 (Promega) with the following ratio ...
-
bioRxiv - Biophysics 2024Quote: ... The next day cells were treated with compounds and assessed for cell growth 5 days later using CellTiterGlo (Promega).
-
bioRxiv - Cell Biology 2024Quote: ... 5 regions of ieCTNNB1 and the region containing the mutation site were respectively cloned into pGL3- promoter vector (Promega). HEK293T ...
-
bioRxiv - Systems Biology 2024Quote: ... Proteins were digested with 5 µL of 100 mM Ambic pH 8.8 that contained ∼250 ng/µL of Trypsin/rLysC enzyme mix (Promega) (Total amount 1.25 µg ...
-
bioRxiv - Immunology 2021Quote: ... followed by three washes with TBS-T and 1 hr incubation in TBS-T + 1% milk + anti-mouse serum (1:10,000) (Promega). All steps were carried out at room temperature ...
-
bioRxiv - Neuroscience 2019Quote: ... Thawed tissue was minced and incubated in 1% PFA (with 1 µL mL−1 RNasin Plus (Promega, Madison, WI)) for 5 minutes ...
-
bioRxiv - Immunology 2022Quote: ... Pelleted cells were incubated with ONE-Glo reagent for 30 minutes at room temperature following the ONE-Glo Luciferase Assay System protocol from Promega (Catalog # E6130). Luminescence was quantified by the Synergy H1 Hybrid reader (BioTek ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... using the CytoTox-ONE Homogeneous Membrane Integrity assay according to the manufacturer’s instructions (CytoTox-ONE Homogeneous Membrane Integrity Assay; #G7891, Promega, Madison, United States). 50 µl medium from each well was removed ...