Labshake search
Citations for Promega :
1001 - 1050 of 1622 citations for 5 2 Chloronicotinoyl 2 furoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... 5 µl of 5x optimized transcription buffer (Promega), 2 µl of T7 RNA polymerase (20 U.ml-1) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and then 5 ng/μL of trypsin (Promega) was added and samples incubated over night at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μl NanoGlo substrate (Promega GmbH, Germany, #N1110) diluted 1:100 in the supplied lysis buffer and was mixed with the 50 μl culture in a white 96-well plate and bioluminescence was determined after 3 min incubation using an Orion II Microplate Luminometer (Berthold Technologies GmbH and Co ...
-
bioRxiv - Biophysics 2023Quote: ... 5 μL of NanoBiT Nano-Glo reagent (Promega N2012 ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... 5 μL of GoTaq qPCR Master Mix (Promega), and 250 nM primer (Supplementary Table S2) ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng renilla control reporter vector (Promega), using TransIT-X2 transfection reagent (Mirus Bio ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM DTT with sequencing-grade trypsin (Promega) for one hour at room temperature with 1:800 or 1:1600 mass (w/w ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 5 ng renilla control reporter vector (Promega), mock luciferase ...
-
bioRxiv - Genomics 2024Quote: ... lysed by a 5× reporter lysis buffer (Promega) and incubated overnight at −20°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 µM HaloTag PEG-biotin ligand (G859A; Promega) or an equivalent amount of DMSO was added ...
-
bioRxiv - Genomics 2020Quote: RNA was isolated via acid-phenol extraction.72 RNA was DNase treated with RQ1 DNase (Promega M6101) by addition of 5µL RQ1 buffer and 5µL RQ1 DNase to each RNA sample ...
-
bioRxiv - Plant Biology 2022Quote: Glutathione and Ascorbic acid content were quantified using the GSH-GLO Glutathione Assay Kit (Promega, Madison, USA) and Megazyme kit (K-ASCO 04/19 ...
-
bioRxiv - Microbiology 2020Quote: Genomic deoxyribonucleic acid (gDNA) was isolated from each mutant using the Wizard® gDNA purification kit (Promega). Illumina NextSeq was then performed by the Genomic Services Facility at Indiana University Center for Genomics and Bioinformatics ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was extracted using the Maxwell® RSC Viral Total Nucleic Acid Purification Kit (Cat# AS1330, Promega) or Maxwell® RSC miRNA from Plasma or Serum (Cat# AS1680 ...
-
bioRxiv - Cell Biology 2024Quote: ... One μg of mass spectrometry grade trypsin (Trypsin Gold, Promega; 1 mg/mL in 0.03% acetic acid) was added ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by the addition of 5-μL Endo-H reaction buffer and 5-μL Endo-H (Promega Cat#PRV4875, 2,500-U). Deglycosylation proceeded for 4-hours at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Genomics 2024Quote: ... extracted from 5 HPVL and 5 LPVL (Table S3, Petersen et al., 2021) were treated with the DNase RQ1 (Promega, US). Then ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full-length fragment of human PFKFB3-5 was amplified with primers PFKFB3-5 reverse and PFKFB3-5 forward and subcloned into the plasmid pGEM-T using the T/A Cloning Kit (Promega, Mannheim, Germany). Subsequently ...
-
bioRxiv - Neuroscience 2023Quote: ... A fragment of the rat Piezo 1 cDNA was amplified with Taq Polymerase and the oligonucleotide primers 5’-GAGGAAGAGGACTACCTT and 5’-TTTACTTAGAAAACCCTACAG from bladder total RNA and cloned into the pGEM-T Easy vector (Promega, Madison, WI). Sequence was confirmed by Sanger capillary sequencing and sense and antisense RNA probes were synthesized with T7 and SP6 RNA polymerases (Roche-Sigma-Aldrich) ...
-
bioRxiv - Genomics 2020Quote: ... We removed RNA species in the nucleic acid via the addition of 4 μg of RNase A (Promega), and incubation at 37°C for 1 hour ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were digested by addition of 0.25 μg of sequencing grade trypsin dissolved in 50 mM acetic acid at 0.5 μg/mL (Promega) overnight at 37 °C with vigorous shaking ...
-
bioRxiv - Microbiology 2021Quote: Viral RNA was extracted from all samples using the Maxwell RSC Viral Total Nucleic Acid Purification Kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... viral RNA was extracted from all samples using the Maxwell RSC Viral Total Nucleic Acid Purification Kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated using the Viral Total Nucleic Acid kit for the Maxwell RSC instrument (Promega, Madison, WI) following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... Human Gβ with a C-terminal 15-amino-acid polypeptide linker followed by a HiBiT (peptide 86, Promega) and human Gγ were cloned into pFastBac vector ...
-
bioRxiv - Cell Biology 2022Quote: ... Peptide solution was then acidified to 0.1% formic acid before adding 0.2 μg Mass Spec grade ProAlanase protease (Promega) and incubating at 37°C for a further 2 h ...
-
bioRxiv - Cell Biology 2022Quote: ... then alkylated with 1.9 mg/mL chloroacetic acid before proteolytic digestion with 0.2 μg sequencing grade ArgC (Promega) and incubation at 37°C for 16 h ...
-
bioRxiv - Biochemistry 2024Quote: ... or gels where Arm A and Arm B ran together) before staining with Diamond Nucleic Acid Stain (Promega) for 20 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µL of 5X GoTaq Green Master Mix (Promega), 0.125 µL of 5u/µL GoTaq G2 polymerase (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... containing 5 x 104 Jurkat effector cells (Promega # G701A) and serial dilutions of indicated human mAbs ...
-
bioRxiv - Systems Biology 2020Quote: 100 mM TEAB and 5 ug trypsin (Promega V5113)
-
bioRxiv - Neuroscience 2021Quote: ... + 5% RNAse inhibitor (40U/ul, Promega RNAsin inhibitor N2511). Samples were then transferred to a tube for processing by our Genome Technology Access Center (GTAC ...
-
bioRxiv - Neuroscience 2021Quote: ... we used 5 μL of 5X RT buffer (Promega), 5 μL of dNTPs ...
-
bioRxiv - Cancer Biology 2021Quote: ... then digested with 5 ng / μl Trypsin Gold (Promega) in 9% Acetonitrile and 40 mM Ambic ...
-
bioRxiv - Immunology 2021Quote: ... 5 ng of Renilla luciferase plasmid (Promega pRL-CMV), and 50 ng of Gal4-DNA binding domain-human RORγt-ligand-binding domain fusion protein plasmid per each well ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 µl of 5X Green GoTaq Buffer (Promega, M791A), 0.2 µl of GoTaq DNA polymerase (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... containing 5 x 104 Jurkat effector cells (Promega # G701A) and 10 μl of pooled mouse sera from naïve or immunized mice with HCoV-OC43 N-His ...
-
bioRxiv - Molecular Biology 2023Quote: ... ∼ 5 × 105 U2OS cells were transfected using FuGene6 (Promega) with 1μg of gRNA/Cas9 (px330 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Constructs were labeled with 5 μM Halo-TMR (Promega) in the column for 10 minutes at room temperature and unbound dyes were washed with TEV buffer at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% glycerol) with protease inhibitor mixture without EDTA (Promega), followed by the addition of 0.3% CHAPS ...
-
bioRxiv - Genetics 2024Quote: ... 5 µL of GoTaq G2 Green Master Mix (Promega), and 200 µM of primers ...