Labshake search
Citations for Promega :
1001 - 1050 of 4194 citations for 1 3 Bis 2 4 hydroxyphenyl 2 propyl benzene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... and 2 µg of RNA were used for reverse transcription into complementary DNA (cDNA) using M-MLV Reverse Transcriptase (Promega, Madison, WI, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Peptide digestion was initiated by adding 25 µL of 50 mM ammonium bicarbonate buffer (pH 8) containing 2 µg trypsin (Sequencing Grade Modified Trypsin, Promega, Cat. no. V5117) directly on top of the column and incubating overnight at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... beads were equilibrated in 50 mM of ammonium bicarbonate with 2 washes followed by on-bead digestion with trypsin (800 ng; Promega cat. nr. V5280) overnight at 37 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... followed by the secondary antibody for 1 h at +4 °C (anti-rabbit IgG-HRP, Promega 65-6120). The Pierce® enhanced chemiluminescence substrate (Thermo-Fischer Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... the beads with bound recombinant proteins were blocked for 1 h at 4°C using reticulocyte lysate (Promega). Next ...
-
bioRxiv - Systems Biology 2023Quote: ... Samples were diluted 1:4 with 50 mM Tris/HCl (pH 8.0) and sequencing grade modified trypsin (Promega) was added in an enzyme-to-substrate ratio of 1:50 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... pre-ran reaction solutions were incubated with 1 µL RNase A (4 mg/mL RNAse A solution, Promega), and 1 µL RNase One (10 units/µL RNase ONE Ribonuclease solution ...
-
bioRxiv - Bioengineering 2020Quote: ... β-mercaptoethanol (3.4 × 10−4%, Promega) and Penicillin (1% ...
-
bioRxiv - Bioengineering 2020Quote: ... β-mercaptoethanol (3.4 × 10−4%, Promega) and Penicillin (1% ...
-
bioRxiv - Bioengineering 2020Quote: ... β-mercaptoethanol (3.4 × 10−4%, Promega) and Penicillin (1% ...
-
bioRxiv - Microbiology 2021Quote: ... 4 μl 5× Buffer (Promega), 2 μl MgCl2 (25mM) ...
-
bioRxiv - Microbiology 2023Quote: ... 4 mM magnesium chloride (Promega), 0.4 mM dNTPs (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... 4% PEG 8000 (Promega, V3011), 5 mM NaCl ...
-
bioRxiv - Neuroscience 2024Quote: ... containing 4% D-luciferin (Promega). The luciferase substrate permeated the cells for 120 min at 37 ℃ ...
-
bioRxiv - Neuroscience 2024Quote: ... 4 units RQ1 DNase (Promega), protease and phosphatase inhibitors (ThermoFisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μL RRV-P3 plasmid or 3 μL of cDNA from rose tissue or nuclease-free water (Promega, Madison, WI). The final volume of the LAMP reaction was 25 μL.
-
bioRxiv - Immunology 2021Quote: ... JEG-3 viability after 1 h salubrinal pretreatment followed by 48 h ZIKV infection was measured by CellTiter-Glo Assay (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... The cells were then washed three times with 1 × PBS and blocked with 3% Blot-Qualified bovine serum albumin (BSA, Promega) in 1 × PBS containing 0.05% Tween-20 (TPBS ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the pSARP-12R4-9 input library with a 3:1 transfection reagent:DNA ratio using Fugene 6 transfection reagent (Promega #E269A). At 72 hrs ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA-TBST for 1h at room temp ...
-
bioRxiv - Molecular Biology 2022Quote: ... The SELENOP 3’UTR and the control plasmid were linearized using Bsb 1 and in vitro transcribed using the Ribomax kit (Promega). The RNA was then purified using p30 size exclusion columns (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... The cytotoxicity of compounds (100 uM to 1 uM, 3-fold dilution) was examined using the CellTiter-Glo Luminescent Cell Viability Assay (Promega). Cell cytotoxicity data was normalized to DMSO control as 0% cell death.
-
bioRxiv - Molecular Biology 2022Quote: ... The ObLiGaRe-TLR construct was co-transfected with Zinc Finger Nuclease (ZFN)-AAVS1 plasmid in a 1:3 ratio using FuGENE transfection reagent (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA -TBST for 1h at room temp ...
-
bioRxiv - Cancer Biology 2023Quote: ... We co-transfected cells with the Tol2 GIV transposon and a Tol2 transposase (Vector Builder) at a 3:1 ratio of micrograms of plasmid DNA using Fugene 6 (Promega) according to the manufacturer’s directions ...
-
bioRxiv - Biophysics 2023Quote: ... Bacmids for the wild type and all Xl-HAS-1 mutants were purified from 3 white colonies and transfected into Sf9 cells at 1×106 cells/mL using the FuGene reagent (Promega). Cells were maintained in ESF921 medium (Expression Systems ...
-
bioRxiv - Microbiology 2023Quote: ... For transient expression experiments each well was transfected with 100 ng of DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Twenty-four hours after transfection or doxycycline stimulation ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: For NanoBIT experiments 12,000 HeLa cells were seeded in 96-well black plates and each well was transfected with 100 ng of total DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Different amounts of plasmid DNA were used to achieve comparable expression of LgBiT/FLAG-tagged and SmBiT/V5-tagged proteins ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfection was performed with 1 μg of plasmid DNA in combination with 3 μL of Fugene HD transfection reagent per well (Promega).
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were washed 3 times for 10 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 5% non-fat dry milk -TBST for 1 h at RT ...
-
bioRxiv - Genomics 2024Quote: ... Reverse transfection was done using a ratio 3:1 volume-to-mass ratio of FuGENE6 (0.3 µL reagent: 100 ng of DNA per well, Promega E2691). The transfection mix included the following vectors ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were seeded onto acid-washed coverslips to ensure surface cleanliness and cell adherence at a density of 3 × 104 cells per coverslip for 24 h before transfection with 1 μg of plasmid DNA using 3 μL Fugene HD transfection reagent (Promega). HaloTagged AP2-σ2 was visualized by adding the JF646-HaloTag ligand (Promega) ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were incubated ∼18 hours at 37°C and individual white colonies screened for insert by colony PCR using primers M13_F (5’-ACGACGTTGTAAAACGACGGCCAGT-3’) and M13_R (5’-ATTTCACACAGGAAACAGCTATGACCA-3’) GoTaq DNA Polymerase (Promega). Reactions were separated by gel electrophoresis ...
-
bioRxiv - Physiology 2022Quote: Caspase 3/7 activity was determined using the Caspase-Glo® 3/7 assay (Promega, Madison, WI, USA) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Caspase 3 and/or 7 activity was assessed with Caspase-Glo 3/7 assay purchased from Promega (G8090).
-
bioRxiv - Immunology 2020Quote: ... the Caspase 3/7 activity of hemocytes was determined with the Caspase-Glo 3/7 assay (Promega, USA). While the apoptosis rate was evaluated using FITC Annexin V Apoptosis Detection Kit I (BD PharmingenTM ...
-
bioRxiv - Genetics 2022Quote: ... The DNM1 amplification was performed with specific primers pair (DNM1_Forward 5’-GGGTCTTGTACGGAGCAGGG-3’ and DNM1_Reverse 5’-GAGTCAGATAGTAAGGGCAAGCAC-3’) using Pfu DNA polymerase (Promega). After the first amplification to select DNM1 fragment of 761 bp ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Caspase 3/7 activity was determined using the Caspase-Glo® 3/7 assay (Promega, Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Caspase 3/7 activities in were assessed by using Caspase-Glo 3/7 assay (Promega Corp., Madison, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Caspase-3/7 activity in leukemia cells were detected by Caspase-Glo 3/7 Assay System (G8091; Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: Caspase 3/7 activity was determined using the Caspase-Glo 3/7 Assay Kit (Catalog No. G8091, Promega) for each sample according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Caspase 3/7 activity was determined using the Caspase-Glo® 3/7 assay (Promega, Madison, WI, USA) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Caspase-3/7 was quantified using the Apo-ONE® Homogeneous Caspase-3/7 Assay (Promega, Fisher scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Caspase 3/7 Glo (Promega #G8091) were added and assayed according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3 μL of Cell Titer Glo (Promega) were added to each well ...