Labshake search
Citations for Promega :
851 - 900 of 4194 citations for 1 3 Bis 2 4 hydroxyphenyl 2 propyl benzene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative RT-PCR (qPCR) reactions were conducted in a 10-µL total volume using a 2× GoTaq® qPCR Master Mix (Promega) and run on an ABI 7500 qPCR thermocycler (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Neuroscience 2022Quote: ... astrocytes were collected and processed after a 2-hour incubation period to determine intracellular glutamate levels using the Glutamate-Glo™ Assay (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Peptide digestion was initiated by adding 25 μl of 50 mM ammonium bicarbonate buffer (pH 8) containing 2 μg trypsin (Sequencing Grade Modified Trypsin, Promega #V5117) directly on top of the column and incubating overnight at 37 °C in a drying oven ...
-
bioRxiv - Cell Biology 2021Quote: ... The primary MEFs were immortalised by transfection of 2 μg of simian virus 40 large T-antigen-expressing vector employing Fugene 6 Transfection Reagent (Promega, E2311) followed by five rounds of a 1 in10 split to achieve 1/100,000-fold splitting ...
-
bioRxiv - Molecular Biology 2020Quote: ... cell pellets were lysed in polysome lysis buffer (gradient buffer containing 100 mM KCl, 10 mM MgCl2, 0.1% NP-40, 2 mM DTT, and 40 U/ml RNasin; Promega, Leiden, Netherlands), and onto 17–50% sucrose gradients and ultracentrifuged for 2 h at 40,000 rpm ...
-
bioRxiv - Systems Biology 2020Quote: ... we cloned synthetic fragments of HERV DNA (sequences in Table S8) using gBlocks® (Integrated DNA Technologies) into psiCHECK-2 (Promega). The fragments were inserted downstream of the Renilla luciferase gene using XhoI and NotI restriction sites and DNA ligation ...
-
bioRxiv - Immunology 2020Quote: Viable cell numbers were quantified either by Trypan blue exclusion or by the production of formazan product (OD490) 2 hours after addition of CellTiter 96® Aqueous One Solution assay reagent (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... 23.5 μl PCR master mix (20 μl Buffer 5X, 2 μl dNTPs 10 μM, 1.5 μl GoTaq; Promega, cat. no. M3001), and 5 μl of Forward universal primer ...
-
The human sperm basal body is a complex centrosome important for embryo pre-implantation developmentbioRxiv - Developmental Biology 2021Quote: ... The resulting protein extract was first diluted to 2M urea for overnight digestion with LysC (Wako, USA) at 37°C and then diluted 2-fold for 8 h digestion with trypsin (Promega, USA) at 37°C.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... HEK293T cells were transiently transfected using Lipofectamine 2000 with 50 ng each of GLP-1R-SmBit and LgBit-β-arrestin-2 (Promega) diluted in pcDNA3.1 ...
-
bioRxiv - Microbiology 2022Quote: Various KSHV mRNA 5’-UTRs containing uORFs were cloned up stream of the Renilla luciferase gene in a psiCHECK™-2 vector (Promega) using a Gibson Assembly® Cloning Kit (New England Biolabs) ...
-
bioRxiv - Microbiology 2022Quote: ... 2 × 106 cells of each strain were mixed completely with equal volumes of the BacTiter-Glo reagent (Promega Corporation, Madison, WI), followed by incubation at room temperature for 15 min in the dark ...
-
bioRxiv - Molecular Biology 2023Quote: ... phosphorothioated and phosphorylated/phosphorothioated forward primers as well as a phosphorylated reverse primer were done in qPCR reaction mixtures including 1X reaction mixture of GoTaq 2-Step RT-qPCR kit (Promega, USA), 400 nM forward and reverse primers and in final volume of 20 μL ...
-
bioRxiv - Neuroscience 2024Quote: ... Peptide digestion was initiated by adding 25 µL of 50 mM ammonium bicarbonate buffer (pH 8) containing 2 µg trypsin (Sequencing Grade Modified Trypsin, Promega, # V5117) directly on top of the column and incubating overnight at 37 °C ...
-
bioRxiv - Immunology 2024Quote: ... Quantification of SARS-CoV-2 RVP infection was determined using the Renilla-Glo® luciferase assay system (Promega Corp., Madison, WI). Microtiter assay plates were centrifuged for 5 min at 2000 rpm to prevent cell loss ...
-
bioRxiv - Immunology 2023Quote: ... reverse primer – GCTTCATCTCAACCTCCGTC) using genomic DNA from monocytes and ligated in dual luciferase reporter vector psiCHECK-2 downstream of Renilla luciferase (Promega Corporation) vector in Xho1 and Not1 sites in MCS ...
-
bioRxiv - Biophysics 2023Quote: ... transfection was carried out by adding 2 μg of freshly prepared bacmid DNA and 6 μL of FuGene HD transfection reagent (Promega, E2311), following the instructions provided by the manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μL of furimazine substrate was added to the reaction well from a working reagent stock of a 2:100 NanoDLR Stop & Glo Substrate to Buffer ratio (Promega #N1610). A total well volume of approximately 112.5 μL was incubated at room temperature for 2 minutes prior to measuring luminescence and OD600 readings on an EnVision plate reader (PerkinElmer).
-
bioRxiv - Cell Biology 2023Quote: ... the 200k pellets were digested for 2 h at 37°C with 0.4 µg of Trypsin/Lys-C (Promega CAT#: V5071) and then overnight by adding 0.4 µg of Trypsin/Lys-C ...
-
bioRxiv - Genetics 2023Quote: ... After adding 2 µg MS grade trypsin in the intraspecific hybrids (Pierce Biotechnology, Waltham, MA) and polyploids (Promega Corporation, Madison, WI) to each sample ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2 µg of bacmid DNA were used to transfect Sf21 cells for baculovirus generation using FuGENE® transfection reagent (Promega). The protein was expressed in Lonza Insect-EXPRESS™ medium for 72-96 h ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Levels of reporter mRNAs in eggs were measured 6 hrs post-injection by RT-qPCR using the GoTaq 2-Step RT-qPCR system as per manufacturer’s instructions (Promega, Madison, WI) with random primers for reverse transcription and oligos listed in Table 1 for the qPCR step.
-
bioRxiv - Neuroscience 2023Quote: ... equal amount of RNA (2 μg) from each sample was subjected to cDNA synthesis using reverse transcriptase Kit (Promega Corporation, USA) following standard procedures ...
-
bioRxiv - Microbiology 2023Quote: ... for 2 hours at 72 hours and lysed at 98 hours using 25 μl Dual-Glo® Luciferase Assay System (Promega). Luminescence was measured ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 2 µl of the lysed samples were added to 25 µl PCR reactions with GoTaq Green mastermix (Promega, Cat. No. M7123). After amplification ...
-
bioRxiv - Microbiology 2024Quote: ... Contaminating DNA in the samples were removed through incubation at 37°C for 2 h using RNase-free DNase I (Promega, USA). All RNAs in the samples were converted into cDNA using a cDNA EcoDry Premix (Clontech ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of RNA was used astemplate to generate cDNAs using the ImProm-II Reverse Transcription system (Promega, Madison, Wisconsin, USA). qPCR reactions were carried out on an MX3000P system (AgilentTechnologies ...
-
bioRxiv - Plant Biology 2024Quote: ... The FLAG-tagged VRS5 and GFP were expressed in-vitro using 2 µg plasmid and TnT® SP6 High-Yield Wheat Germ Protein Expression System (Promega). Expressed FLAG-tagged proteins were bound with prepared DNA libraries for 2 hours at RT followed by immobilization by anti-FLAG magnetic beads (SIGMA) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were incubated for one hour at 47°C with 2 µg of sequencing grade trypsin (Promega, San Luis Obispo, CA) dissolved in 50 mM TEAB ...
-
bioRxiv - Immunology 2024Quote: SARS-CoV-2 variant spike pseudotyped lentiviral particles were produced in 293T cells (ATCC) using Fugene transfection reagent 6 (Promega; E2691). Two million cells were seeded in D10 (DMEM(Life Technologies ...
-
bioRxiv - Immunology 2024Quote: ... nLuc signal was quantified within 2 hr following 50 µL intraperitoneal injection of reconstituted Nano-Glo in Vivo FFz substrate (Promega, CS320501) as photons per sec (p/s ...
-
bioRxiv - Bioengineering 2024Quote: One hundred micrograms of each antibody were reduced with 50 mM DTT and treated with 2 µl PNGase F (Promega, USA) at 37°C for over 16h with stirring before being transferred to a new vial for LC-MS analysis ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 48 hours (Figure 2) of drug exposure at 37°C/5% CO2 and assayed for cell viability using CellTiter-Glo® (Promega) by following manufacturer instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... for 4 h at 800 rpm and 42°C or thermolysine (1:50) (Promega, Walldorf, Germany) for 2 h at 800 rpm and 60°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 µL of PBS containing 4 μg/mL Hoechst and 1/10000 CellTox Green Dye (Promega) were were dispensed per well 1 h prior to imaging at Cytation5 image cytometer or Opera Phenix (Perkin Elmer ...
-
bioRxiv - Cancer Biology 2023Quote: ... or MEK inhibitor U0126 (1, 10, and 50 µM for 4 h; Promega, Madison, WI, USA). A corresponding volume of dimethyl sulfoxide (Nacalai Tesque ...
-
bioRxiv - Microbiology 2020Quote: ... caspase-3/7 activity was quantified using the Caspase-Glo-3/7 assay system (Promega). Luminescence was quantified using plate reader Synergy H1 Hybrid Reader (BioTek).
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase-3/7 activity was measured using Caspase-Glo 3/7 Assay Systems (G8091, Promega) according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2021Quote: Caspase 3/7 activity was measured using Caspase-Glo® 3/7 Assay (Promega, G8090) per the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... Caspase 3/7 activity was assessed using the Caspase-Glo 3/7 assay reagent (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: The intracellular caspase-3/7 activity was measured using Caspase-Glo 3/7 Assay (Promega). For this ...
-
bioRxiv - Cell Biology 2022Quote: ... Caspase 3/7 activity was measured by adding Caspase-Glo 3/7 Assay Reagent (Promega), incubating for 45 min at room temperature and measuring luminescence in an EnVision 2104 Multilabel plate reader (PerkinElmer).
-
bioRxiv - Microbiology 2022Quote: ... for Calu-3 cells and CellTiter-Glo 3-D Cell Viability Assay Kit (Promega, Germany) for hBAECs according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... Caspase-3/7 activity was detected using the Caspase-Glo 3/7 Assay Kit (Promega) according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Caspase 3/7 cleavage activity was measured by Caspase-Glo 3/7 Assay Kit (Promega). 1 ×104 cells/well were plated in a pre-coated 96-well plate ...
-
bioRxiv - Cancer Biology 2024Quote: ... Apoptosis was measured similarly by determining active caspases 3/7 via CaspaseGlo 3/7 (Promega) on day 3 after plating ...
-
bioRxiv - Neuroscience 2024Quote: Caspase 3 activity was measured using commercially available Caspase-Glo 3/7 Assay (G809; Promega) following the manufacturer’s instructions for a 24-well plate ...
-
bioRxiv - Cancer Biology 2022Quote: ... pMD2.G and the lentiviral gRNA plasmid at a 3:1:5 mass ratio using FuGENE HD (Promega) in Opti-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... A DENV-1 3’UTR specific probe was generated by PCR reaction with GoTaq Polymerase (Promega, Wisconsin, USA) containing DIG DNA-labelling mix (Roche ...