Labshake search
Citations for Promega :
1151 - 1200 of 4194 citations for 1 3 Bis 2 4 hydroxyphenyl 2 propyl benzene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... The antibodies used for western blotting were: anti-HALO (1:1000 in 0.5% milk TBST, 4°C o/n, Promega G9211), anti-GAPDH (1:10000 in TBST ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were transduced with the shRNA lentiviruses and selected on puromycin for 4 days before lysis in 1× passive lysis buffer (E1941, Promega) and dual luciferase readout using the Dual-Glo® Luciferase Assay System (E2940 ...
-
bioRxiv - Bioengineering 2024Quote: ... and incubated with the following primary antibodies diluted in TBS-T overnight at 4°C: mouse anti-HaloTag (1:5,000; Promega, G9211), mouse anti-Flag M2 (1:2000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plates were then incubated overnight at 4°C with primary antibodies (mouse anti-LgBIT antibody at 1:750 dilution [Promega N7100] ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA:FuGENE complexes were formed at a ratio of 1:3 (μg DNA/μL FuGENE HD) according to the manufacturer’s protocol (Promega, Madison, WI, USA). The resulting transfection complex (1 part ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected with 1 µg of DNA diluted in 45 µl dMEM and then mixed with 3 µl ViaFect™ (Promega, USA) transfection reagent added and incubate for 20 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... approximately 200,000 HEK-293T cells were transfected with 1 μg of plasmid DNA complexed to 3 μL of FuGENE HD (Promega, Cat: E2311). 16-20 hours post transfection the cells were dissociated from the plastic using cell dissociation buffer (Gibco Cat ...
-
bioRxiv - Biophysics 2022Quote: ... spheroplast/sucrose buffer suspension was added to 500 μL warm (42 °C) agarose solution (low melting point agarose, V2831 Promega, 2% w/v in sucrose buffer) using a cut pipette tip ...
-
bioRxiv - Genomics 2024Quote: ... pooled PCR fragments > 600 bp in length (300 ng per tube x 2 tubes, each diluted with 100 μl of Promega RQ1 DNase 10x buffer (cat. # M6101)) were lightly digested with 0.2 μl of DNase-I (RQ1 RNase-Free DNase-I ...
-
bioRxiv - Cancer Biology 2021Quote: ... The endpoints of the second screen were caspase 3/7 activity measured using the CaspaseGlo® 3/7 assay reagent (Promega) at the 8-hour and 16-hour time intervals ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... DDX60 (Fw 5’- AAGGTGTTCCTTGATGATCTCC-3’ Rv : 5’ -TGACAATGGGAGTTGATATTCC-3’) as analyzed by semiquantitative PCR using the SYBR Green assay GoTaq® qPCR Master Mix (Promega) with standardized primers (Metabion) ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Cell Biology 2024Quote: ... Apoptosis was determined as Caspase-3/7 activity immediately after 6-day culture using Caspase-Glo 3/7 Assay (Promega, USA). Luminescence was recorded with the Infinite M200 PRO microplate reader (Tecan ...
-
bioRxiv - Cancer Biology 2024Quote: ZEB1 3′UTR region with mitomiR-3 binding site was cloned into pmirGLO-Dual Luciferase miRNA target expression vector (Promega, USA) for miRNA luciferase reporter assay (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... Virus-mAb-containing media was then aspirated from cells and 100 mL of a 1:4 dilution of Bio-glo (Promega, G7940) in PBS was added to cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lysates were centrifuged at 500 g for 5 min at 4°C and resuspended in 4 mL of nuclei wash buffer (PBS supplemented with 1% BSA and 0.2U/μL RNasin® Plus Ribonuclease Inhibitor (Promega, N2615). Following another round of centrifugation ...
-
bioRxiv - Microbiology 2021Quote: ... Virus-mAb-containing media was then aspirated from cells and 100 μL of a 1:4 dilution of Bio-glo (Promega, G7940) in PBS was added to cells ...
-
bioRxiv - Biophysics 2024Quote: ... and incubated at 4°C overnight with the following primary antibodies diluted in TBS-T: mouse anti-HaloTag (1:8000; Promega, G9211), mouse anti-Flag M2 (1:2000 ...
-
bioRxiv - Cell Biology 2024Quote: ... pcDNA-LAAOR322A or pcDNA-LAAOY372A using FuGENE® HD transfection reagent at 1 µg plasmid / 4 µl transfection reagent (Promega, E2312).
-
bioRxiv - Microbiology 2020Quote: ... followed by a reverse transcription using a universal degenerated oligo specific to all 5′ non-coding sequences of BTV-1 segments (BTV/Uni1; 5′ GTTAAAWHDB 3′) and the GoScript Reverse Transcription (RT) System (Promega, Madison, WI, USA). The cDNAs obtained for the segment 7 were then quantified with a real time quantitative PCR (qPCR) ...
-
bioRxiv - Systems Biology 2023Quote: ... at the ratio of 1:50 for 3 h at 37°C and then using trypsin (sequencing grade modified trypsin; Promega, Fitchburg, WI, USA) at the ratio of 1:50 at 37°C overnight (for 15 h to 18 h ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 ng of Renilla (pRL-CMV, Promega), and 0.12 μL of X-tremeGENE HP ...
-
bioRxiv - Genetics 2022Quote: ... 4 units RQ1 RNase-free DNase (Promega), protease and phosphatase inhibitor mix (Halt ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 U RNaseIn plus Ribonuclease Inhibitor (Promega), 1 mM NaF and 100 µM luciferin (Promega)] to a final volume of 15 µl with water ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 µl of RQ DNAse I (Promega), 21 µl of nuclease-free water and 5 µl of CaCl2 (10mM ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 4 μL/well of Bright-Glo (Promega) was dispensed ...
-
bioRxiv - Genomics 2020Quote: ... 4 × Protease Inhibitor (Promega, Cat. No. G6521)] ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and 4 μl of FuGENE 6 (Promega) in 100 μl of OPTI-DMEM ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 4 U/μl reverse transcriptase (Promega). 2 µl of cDNA were used for Real-Time PCR with self-designed primers and SYBR green reaction (Roche) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4 µl 5x reaction buffer (Promega, M289A), 2.4 µl MgCl2 (Promega ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4 µl 5x reaction buffer (Promega, M289A), 2.4 µl MgCl2 (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 ng of Renilla control plasmid (Promega) and 0.62 μL of Lipofectamine 2000 Transfection Reagent (InvitrogenTM) ...
-
bioRxiv - Cell Biology 2024Quote: ... and 4 U/mL RQ1 DNase (Promega), samples were incubated at room temperature (25°C ...
-
bioRxiv - Biochemistry 2024Quote: ... 4 µL Mg2+ free PCR buffer (Promega), 4 µL 25 mM MgCl2 ...
-
bioRxiv - Biochemistry 2024Quote: Flexi Rabbit Reticulocyte Lysate (4 μL, Promega) was diluted with 4 μL solution containing amino acid mixture (100 μM) ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Cell Biology 2021Quote: ... Caspase 3/7 activity was measured 24 hours post-cytokine treatment using the Caspase-Glo® 3/7 Assay System (Promega, #G8090).
-
bioRxiv - Cancer Biology 2022Quote: ... Apo-one Homogeneous Caspase-3/7 Assay kit was performed according to the manufacturer’s protocol to calculate caspase 3/7 activity (Promega Corporation, Madison, WI). Additionally ...
-
bioRxiv - Cancer Biology 2022Quote: ... cell viability and caspase 3/7 activity were evaluated using CellTiter-Glo and Caspases-Glo 3/7 assays (both from Promega, Madison, WI), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Caspase 3/7 activity was quantified in cell culture by using the Caspase-Glo 3/7 assay system (Promega, Madison, WI, USA). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... 10 μL containing 3 units of DNase I (Promega) and 1 μL of CaCl2 was added ...
-
bioRxiv - Biochemistry 2020Quote: ... 100 µL/well of Caspase 3/7 reagent (Promega) was added per the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the Caspase-Glo® 3/7 assay (Promega).