Labshake search
Citations for Promega :
851 - 900 of 3351 citations for 7H Pyrrolo 2 3 d pyrimidine 7 3 5 bis O 2 4 dichlorophenyl methyl 2 C methyl b D ribofuranosyl 4 chloro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... purified RNAs were additionally incubated with 2 units of RQ1-DNAse (Promega, cat# M6101) per 1 µg of RNA at 37°C for 30 min to eliminate plasmid DNA contamination ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA was generated from 2 µg isolated RNA using M-MLV reverse transcriptase (Promega) and diluted 1:15 for use in 12 µL qPCR reactions run on the StepOnePlus™ system (Applied Biosystem) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1-2 µg of RNA was reverse transcribed into cDNA using GoScript (Promega).
-
bioRxiv - Cancer Biology 2023Quote: ... 2 µg total RNA served as a template using M-MLV Reverse Transcriptase (Promega) and random hexamer primers following manufactureŕs protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... including NCI were spiked with 2 ng of Luciferase Control RNA (LUC) (Promega, USA). These extracts were used for real-time quantitative PCR (RT-qPCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 24 hours later co-transfected with 500 ng psiCHECK™-2 Vector (Promega) containing the 3’UTR of human PLIN2 gene downstream to the Renilla luciferase gene ...
-
bioRxiv - Cell Biology 2023Quote: ... and proteins were further digested by the addition of 2 μg trypsin (Promega #V5113) for 4 hours at room temperature on a shaker ...
-
bioRxiv - Biochemistry 2023Quote: ... peptides were collected as described in ProteaseMax application note (Promega, TB373, Rev. 2/15), and purified using Pierce C18 Spin Tips (Thermo Fisher PI84850) ...
-
bioRxiv - Cell Biology 2024Quote: ... for 20ms with 2 pulses or lipid-mediated delivery using FuGENE HD (Promega; TM328) according to the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2024Quote: ... HaloTagged AP-2 σ2 was visualized by adding Janelia Fluor 646-HaloTag ligand (Promega). Ligand (100 nM ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 μg of RNase A (Promega), and 40 units of RNase ONE (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 µl RT buffer 5x (Promega), 2.5 μl dNTPs 2.5 mM ...
-
Stem cell delivery to kidney via minimally invasive ultrasound-guided renal artery injection in micebioRxiv - Cell Biology 2019Quote: ... Mice were injected intraperitoneally with 75 mg/kg D-luciferin (Promega) in 200 µl of PBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... and then 150 mg/kg D-luciferin (VivoGlo, Promega, Madison, WI) was injected intraperitoneally ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were intraperitoneally injected with D-luciferin (150mg/kg) (Promega, USA) and anesthetized with pentobarbital sodium ...
-
bioRxiv - Physiology 2021Quote: ... with D-luciferin potassium salt (15 mg/kg, Promega, Madison, WI) in sterile phosphate-buffered saline ...
-
bioRxiv - Molecular Biology 2022Quote: ... then supplied with 0.4 μl of 100 mM D-luciferin (Promega) per well ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were then incubated for 30 min at 4 °C slowing rotating with Passive Lysis Buffer (Promega Cat#E1941). After incubation with the lysis buffers ...
-
bioRxiv - Cancer Biology 2021Quote: ... and sequentially digested with Lys-C (Wako) (protein:enzyme ratio 1:50, o/n at RT) and trypsin (Promega) (protein:enzyme ratio 1:50 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The resulting 3’UTR-Wild and 3’UTR-Mutant genes were inserted into the XbaI restriction site of pGL3-control vector (Promega) expressing firefly luciferase ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Initial P0 virus was obtained by addition of ∼3 µg recombinant bacmid DNA mixed with 3 µl FuGENE HD Transfection reagent (Promega) in 100 µl Sf900 II media (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... 2.5 μl TDE1 and 22 μl nuclease-free water were combined and placed at 37°C for 3 min before 0.5 μl of 1% Digitonin (Promega, Cat. #G9441) was added to the master mix ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein was digested with Lys-C (Wako) (1:50 enzyme-to-substrate ratio) for 3 h at 25°C and with sequencing-grade modified trypsin (Promega, V5117) at 25°C for 14 h ...
-
bioRxiv - Microbiology 2019Quote: ... The cells were fixed with 4% paraformaldehyde for 5 min and permeabilised with 0.2 % Triton X-100 (Promega) in PBS for 10 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... ATP solution (5 μL of a 100 μM solution containing 0.1 μg 4:1 glycine:tyrosine peptide substrate (Promega)) was added and incubated at 37 °C for 20 min before the addition of ADP-Glo reagent (5μL ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3’-UTR derived from pNL1.1[Nluc] vector (Promega), and 50 nt poly(A ...
-
bioRxiv - Immunology 2021Quote: ... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
bioRxiv - Systems Biology 2020Quote: ... and T4 DNA ligase (3 U/μί, Promega) were applied to assemble all of the synthetic promoter blocks sequentially and simultaneously into the firefly reporter vector backbone in a one-pot reaction ...
-
bioRxiv - Neuroscience 2019Quote: ... organoids were embedded in 3% agarose (Promega, #V3125), sectioned at 120-µm thickness and collected in 30% sucrose in 1× PBS for cryopreservation ...
-
bioRxiv - Biochemistry 2021Quote: ... 1.8 nM 3 kb supercoiled pGEMT plasmid (Promega), and 20 nM MMTV intasomes in a final volume of 15 µL ...
-
bioRxiv - Zoology 2023Quote: ... and 3% 20 mg/ml Proteinase K (Promega). This digestion eliminates cellular material while leaving the spongin network intact ...
-
bioRxiv - Neuroscience 2021Quote: ... reverse mutant primer oIMR1437 5′-TCC ACC TAG CCT GCC TGT AC-3′) with 1U GoTaq polymerase (Promega, Madison, USA), 1X green GoTaq buffer ...
-
bioRxiv - Microbiology 2019Quote: ... The genes of interest along with ∼700 bp of 3’ and 5’ flanking DNA were amplified and cloned into the vector pGEM-T Easy (Promega) to create pGEMlpg0277 ...
-
bioRxiv - Microbiology 2022Quote: Templates for in vitro transcription of gene-specific 300-500 nt dsRNA and DENV2 EMSA probes were generated by PCR introducing a T7 promoter sequence or a universal tag at both 5’ and 3’ ends using the GoTaq Flexi DNA Polymerase (Promega). If present ...
-
bioRxiv - Systems Biology 2022Quote: ... and 72h in 3-5 wells for each condition (mean values of 3-5 technical replicates are provided for each donor) using a multiwell plate reader Glomax (Promega). Each 2h incubation was performed at a multiplicity of infection (MOI ...
-
bioRxiv - Microbiology 2022Quote: ... was added to a final concentration of 3 mM followed by the addition of 5 µl of T7 Enzyme Mix and 50 U RNasin RNase Inhibitor (Promega). To produce transcripts for mock transfections the GTP concentration was increased to 7.5 mM and cap analogues were not added ...
-
bioRxiv - Immunology 2022Quote: ... that introduced a 5’ KpnI site and a 3’ XhoI site and cloned into the pGL3 firefly luciferase vector (Promega). Site directed mutagenesis was performed as described above ...
-
bioRxiv - Plant Biology 2022Quote: ... primer extension products reverse-transcribed with a gene-specific primer (reverse-complementary to the 16S rRNA nucleotides 1092-1108; 5’-CAGTCTGTTCAGGGTTC-3’) and AMV reverse transcriptase (Promega) were analyzed by qPCR with the primer pairs ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then a final solution comprised of 17% formamide + 5% Triethalomine + 70% glycerol + 3% Tris (w/v, Tris, Promega, H5135) made in basic DDH20 ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2023Quote: ... a pPolI-Firefly plasmid encoding the Firefly luciferase sequence in negative polarity flanked by the 5’ and 3’ non-coding regions of the IAV NS segment was used and the pTK-Renilla plasmid (Promega) was used as an internal control ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Developmental Biology 2024Quote: ... a minimal promoter (5′-AGACACTAGAGGGTATATAATGGAAGCTCGACTTCCAG-3′) and 8x Gli1-binding sites (110) were cloned into the pGL3-Basic vector (Promega), in which Firefly luciferase was replaced with NanoLuc luciferase amplified from the pNLF-N [CMV/Hygro] vector (Promega ...
-
bioRxiv - Cell Biology 2024Quote: ... Oligonucleotides encoding guide RNAs targeting M18BP1 (5’- TTGTACTGAAAAAATCATCA-3’) were cloned into pX459-v2 and co-transfected using FuGENE 6 (Promega) with pUC19 containing a 1528 base pair stretch containing the mutated sequence of the locus of interest and homology arms ...
-
bioRxiv - Molecular Biology 2023Quote: SMC5/6 hexamer purified from E.coli with a C-terminal HALO tag on Nse2 was incubated with a 2-fold molar excess of Janelia-Fluor646 HaloTag Ligand (Promega; 12 µM Smc5/6 hexamer + 24 µM label). After incubation for 1 h at 25°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 µg of RNA was subjected to reverse transcription using M-MLV enzyme (Promega #M1705), dNTP mix 100 mM each (BLIRT #RP65 ...
-
bioRxiv - Microbiology 2020Quote: ... Protein digestion was carried out by adding 2 μg of trypsin solution (Promega, Charbonnières, France) to the alkylated proteins ...
-
bioRxiv - Molecular Biology 2019Quote: ... The linearized plasmid was treated with 2 units of shrimp alkaline phosphatase (Promega, Madison, USA) at 37 °C for 30 min ...
-
bioRxiv - Bioengineering 2021Quote: ... and 1 and 2 μL of 50 ng/μL trypsin (in 100 mM TEABC, Promega) was added to the wells with single cells and two hundred carrier cells ...
-
bioRxiv - Microbiology 2020Quote: ... Amplification was performed in 50 μl final volume using 2 U of GoTaq Polymerase (Promega) and 100 ng of DNA template in each reaction ...