Labshake search
Citations for Promega :
801 - 850 of 904 citations for Porcine Tissue Lysates since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... We extracted the total RNA of the larval stage using ReliaPrep RNA Tissue Miniprep kit (Promega, Madison, WI/USA) according to the supplier’s recommended protocol ...
-
bioRxiv - Immunology 2023Quote: ... Thereafter the samples were processed according to the Manufacturer’s Protocol for ReliaPrep RNA Tissue Miniprep System (Promega, Fitchburg, USA). PBMCs were isolated using histopaque density gradient centrifugation (Sigma ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Total RNA was extracted using the Maxwell® RSC instrument together with the Maxwell® simplyRNA Tissue Kit (Promega) according to the manufacturer’s instructions with a final elution volume of 60 μl ...
-
bioRxiv - Neuroscience 2023Quote: RNA from lyophilized cerebrum and brainstem samples was extracted using the Maxwell® RSC simplyRNA Tissue Kit/Instrument (Promega) with initial homogenization on a TissueLyser LT (Qiagen) ...
-
bioRxiv - Plant Biology 2024Quote: ... Leaf tissue was collected from plants for high-molecular weight DNA extraction (Wizard HMW DNA Extraction, Promega, Madison, WI). We used flow cytometry to estimate genome size relative to Conyza canadensis and Solanum lycopersicum ...
-
bioRxiv - Developmental Biology 2021Quote: ... Limb fragments were immediately transferred in 1.5 ml LowBind tubes with 500 ul of ice-cold lysis buffer (Reliaprep RNA Tissue MiniPrep System, Promega #Z6111), vortexed ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were then pelleted at 300g for 7 minutes and resuspended in 200μL of Homogenization Buffer from the Maxwell RSC simplyRNA Tissue Kit (Promega #AS1340). Cells were then lysed by adding 200μL of lysis buffer and transferred into the Maxwell RSC Cartridge ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μL RRV-P3 plasmid or 3 μL of cDNA from rose tissue or nuclease-free water (Promega, Madison, WI). The final volume of the LAMP reaction was 25 μL.
-
bioRxiv - Molecular Biology 2020Quote: Preserved tissue (10-15 mg) was used for nucleic acid purification by employing the Wizard genomic DNA kit (Promega, USA) and following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: RNA extraction from liver tissue (n=3-6 biological replicates per group) was performed using the ReliaPrep RNA Miniprep system (Promega), as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... the whole brain of postnatal day 6 (P6) animals or dorsal raphe tissue punches (adult animals) were homogenized with Passive Lysis Buffer (Promega) and proteinase inhibitors (cOmplete ULTRA Tablets ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and from the interior of the sponge tissue (<2mm from the exterior pinacoderm) and the seawater filter papers using the Wizard Genomic DNA Purification Kit (Promega).
-
bioRxiv - Plant Biology 2020Quote: ... only root parts (around 100 mg) were collected and total RNA was extracted using a Trizol-adapted ReliaPrep RNA Tissue Miniprep Kit (Promega). For verifying the transcript level in single T-DNA lines ...
-
bioRxiv - Neuroscience 2020Quote: ... Mice were genotyped by extracting DNA from tail clippings with Extracta DNA Prep for PCR – Tissue (Quanta Biosciences) and specified products amplified using either GoTaq Green Mastermix (Promega) or 2x KAPA buffer ...
-
bioRxiv - Plant Biology 2020Quote: ... were collected from each genotype and total RNA was extracted using a Trizol-adapted ReliaPrep RNA Tissue Miniprep Kit (Promega). Reverse transcription was carried out with PrimeScript RT Master Mix (Takara) ...
-
bioRxiv - Plant Biology 2021Quote: ... ground in liquid nitrogen and total RNA from approximately 150 mg of ground leaf material was extracted with a ReliaPrep miRNA Cell and Tissue Miniprep System kit (Promega). A stem loop pulsed RT-PCR protocol [8 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Media from the basal layer of the tissue were collected at the same time points for LDH cytotoxicity measurements (LDH-Glo Cytotoxicity Assay, Promega). TCID50 assay was performed as previously described [19] ...
-
bioRxiv - Cancer Biology 2022Quote: ... HCT116 cell line was treated for 24 h with 10 µM curcumin and RNA was isolated using the Maxwell® 16 IVD system and the Maxwell Simply RNA Tissue Kit according to the manufacturer’s instructions (Promega). RNA was reverse transcribed using the SuperScript® VILO cDNA Synthesis Kit (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... a 10 mm × 10 mm piece of tissue surrounding the inoculation point was applied to the Dual-Luciferase Reporter Assay System (Promega), to detect the firefly luciferase activity (or activation of the ACS2 and ACS2mut promoters) ...
-
bioRxiv - Microbiology 2020Quote: ... The 50% tissue culture infectious dose (TCID50) of SARS-CoV-2 pseudovirus was determined using the Steady-Glo luciferase assay system (Promega).
-
bioRxiv - Cell Biology 2021Quote: The quantification of dead cells in lung tissue was performed using an in-situ apoptosis detection DeadEnd Colorimetric TUNEL System (Promega) as previously described (88) ...
-
bioRxiv - Physiology 2020Quote: ... For the RNA sequencing samples the isopropanol phase of TRIzol extraction was transferred to Reliaprep tissue Miniprep kit (Promega, USA) columns to ensure high quality RNA samples were used ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... total RNA was extracted separately from two 5 mg crushed-tissue samples by using the SV Total RNA Isolation System (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: Cells were harvested by trypsinization and RNA was isolated using Maxwell LEV simply RNA Cells/Tissue Kit (Promega, Madison, USA), according to the company’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: Genomic DNA from the 20 renal cortical tissues procured from the NIH NeuroBioBank were isolated using Wizard genomic DNA purification kit (Promega). The following forward (CCACAAGGGCAGAAAGTATG ...
-
bioRxiv - Cancer Biology 2019Quote: ... Tumor tissue was manually microdissected from the slides and FFPE-DNA and RNA was isolated with the Maxwell system (Promega) according the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Genomic DNA was extracted from a small piece of muscle tissue by using a Maxwell RSC Blood DNA Kit with a Maxwell RSC Instrument (Promega). A shotgun DNA library was constructed using a TruSeq Nano DNA High Throughput Library Prep Kit (Illumina) ...
-
bioRxiv - Immunology 2021Quote: ... paraffin-embedded (FFPE) tissue slides using Maxwell® RSC Blood DNA Kit and Maxwell® RSC RNA FFPE Kit (Promega) following the manufacturer’s recommendations ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... a total of 18 RNA extractions (3 morphs × 3 tissues × 2 biological replicates) were performed using the SV Total RNA Isolation System (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Terminal deoxynucleotidyltransferase-mediated deoxyuridine triphosphate nick-end labeling (TUNEL) staining of paraffin-embedded tissue sections was done with the DeadEnd Fluorometric TUNEL System (G3250, Promega). TUNEL-positive areas from three fields (magnification×10 ...
-
bioRxiv - Neuroscience 2023Quote: ... Mice were genotyped by extracting DNA from tail clippings with Extracta DNA Prep for PCR—Tissue (Quanta Biosciences) and specified products amplified using either GoTaq Green Mastermix (Promega) or 2x KAPA buffer ...
-
bioRxiv - Microbiology 2023Quote: Viral stocks were generated in tissue culture by transfecting MCMV genome-carrying BACs into NIH3T3 cells (ATCC CRL-1658) using FuGene HD (Promega). Reconstituted viral particles were passaged five times on M2-10B4 cells (ATCC CRL-1972 ...
-
bioRxiv - Bioengineering 2023Quote: ... 2000 transfected cells were replated into white 384-well tissue culture plates in the presence or absence of 1 μM HaloTag NanoBRET-618 Ligand (Promega) and incubated overnight at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: Apoptotic DNA fragmentation was analyzed using the DeadEndTM Fluorometric TUNEL System according to the standard paraffin-embedded tissue section protocol (Promega). The DNAs in nuclei were stained with DAPI at the final preparation step ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 5 × 104 transfected cells were replated into white 96-well tissue culture plates in the presence or absence of HaloTag NanoBRET 618 Ligand (Promega) and incubated overnight at 37 °C ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA was extracted from frozen ground tissues using the innuPREP Plant RNA kit (Analytic Jena) and digested with RQ1 DNase (Promega). First-strand cDNA synthesis was conducted on 1 µg RNA using the SuperScript III Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... with 2% 1-thioglycerol using a Bio-Gen PRO200 homogenizer (PRO Scientific, Oxford, USA) and then extracted RNA using the Maxwell RSC simplyRNA Tissue Kit (Promega). We quantified extracts using a Quant-IT RNA Assay Kit ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA was isolated from 30 mg of ground plant tissue using the SV Total RNA Isolation System Kit (Promega) and its concentration and integrity were assessed using the RNA 6000 Nano Kit on a Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Genetics 2024Quote: ... We prepared triplicate tissue homogenates from ten F1 progeny from each cross using the Luciferase Cell Culture Lysis 5X Reagent (Promega) to extract total proteins by following the quick-freeze homogenization method outlined by the manufacturer ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA from RHE was extracted using the “ReliaPrep™ miRNA Cell and Tissue Miniprep System” (Promega Cat#Z6111, Wisconsin, USA) and its concentration measured by NanoDrop 1,000 spectrophotometer (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... Viral RNA was isolated from homogenized tissues using the Maxwell 48 RSC Viral Total Nucleic Acid Purification Kit (Promega, Madison, WI) on a Maxwell 48 RSC instrument ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA of the eggs was extracted and treated with DNase I using the ReliaPrep RNA Tissue Miniprep System (Promega, USA). Total RNA of the primary queens or kings was separately extracted from the body (except for the head parts ...
-
bioRxiv - Neuroscience 2021Quote: RNA was extracted from 10 flies for each experiment condition and the process followed the protocol of Promega ReliaPrepTM RNA Tissue Miniprep System kit (Promega, Z6110). Extracted RNA was stored in a −70°C refrigerator ...
-
bioRxiv - Plant Biology 2019Quote: Total of RNA was extracted from various tissue of plants by using the Eastep®Super Total RNA Extraction Kit (Promega). The cDNA was synthesized from Dnase I treated total RNA using M-MLV 1st Strand Kit (Invitrogen) ...
-
bioRxiv - Cancer Biology 2019Quote: ... genomic DNA was extracted from freshly isolated zebrafish brains following the instruction of ReliaPrep™ gDNA Tissue Miniprep System (Promega Corporation) and then 3µg of genomic DNA were digested with RsaI and HinfI enzymes (New England Biolabs ...
-
bioRxiv - Cancer Biology 2021Quote: The anal tissue was scraped from H&E stained slides using a sterile blade.[13] The deparaffinization and genome DNA extraction from H&E stained anal tissues was performed according to manufacturer’s instructions using ReliaPrep FFPE gDNA MiniPrep System (Promega, Madison, WI).
-
bioRxiv - Molecular Biology 2022Quote: Total RNA was extracted from lung tissue using the Maxwell automated instrument and the Maxwell® RSC Viral Total Nucleic Acid Purification Kit (Promega). The concentration of RNA and quality were measured with HS Total RNA 15nt.methods (Agilent ...
-
bioRxiv - Cancer Biology 2022Quote: ... GB02 and GB03 using the Maxwell® 16 Instrument with the Maxwell® 16 Tissue DNA Purification Kit (Promega, Madison, WI). DNA concentration was determined using the Qubit Fluorometer (Life Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... or 1/6th of the diaphragm) using a Maxwell RSC Instrument and Maxwell RSC simplyRNA Tissue Kit (both Promega, Southampton, UK) and complementary DNA (cDNA ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA was isolated from liver homogenates of MOP-NaCl control and MOP-IFNα-treated mice by using the ReliaPrep™ RNA Tissue Miniprep System (Promega) and DNAse TURBO (Thermo Fisher Scientific ...