Labshake search
Citations for Promega :
701 - 750 of 1454 citations for 7 Oxa 12 thia spiro 5.6 dodecan 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Growth inhibition measured at 490 nm by CellTiter 96 AQueous One Solution Cell Proliferation assay (Promega). Viability (100 % ...
-
bioRxiv - Microbiology 2021Quote: ... 20 µL of the MTS salt containing CellTiter 96 Aqueous One Solution reagent (Promega, Madison, WI) was added and incubated for further 1-2 h at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... the cell viability was assessed using Celltiter 96®AQueous One Solution (Promega Corp, WI, USA) or CellTiter-Glo® One Solution Assay system (Promega ...
-
Inclusion Complexation of S-Nitrosoglutathione for Sustained NO Release and Reduced Device InfectionbioRxiv - Biochemistry 2022Quote: ... The CellTiter 96® AQueous One Solution Cell Proliferation Assay (MTS) kit was obtained from Promega Corporation.
-
bioRxiv - Molecular Biology 2022Quote: ... The genomic DNA concentration was quantified using the Quantifluor® ONE dsDNA Dye System (E4971, Promega). Genomic DNA (5–20 ng ...
-
bioRxiv - Cancer Biology 2020Quote: ... 20 μL of CellTiter 96 Aqueous One Solution cell proliferation assay (MTS) (Promega, Cat. No. G3581) was added to each well ...
-
bioRxiv - Microbiology 2021Quote: ... For MTS assays the CellTiter 96® AQueous One Solution Cell Proliferation Assay (MTS) from Promega was used (Promega #G3580) ...
-
bioRxiv - Cell Biology 2021Quote: ... the luminescence of each well was measured using a ONE-Glo™ Luciferase Assay System (Promega) in the Infinite M200 Pro NanoQuant (TECAN) ...
-
bioRxiv - Epidemiology 2021Quote: ... Cell Titer 96 Aqueous One Solution Cell Proliferation assay (MTS) was purchased from Promega (Madison, USA). Goat anti-mouse IgG ...
-
bioRxiv - Biochemistry 2021Quote: ... Reacted sequences were isolated by addition of one sample volume of Streptavidin MagneSphere paramagnetic beads (Promega) per sample ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was synthesized from one μg RNA with GoScript™ Reverse Transcription System (Promega, Benelux BV) and thereafter diluted to 1:30 (v/v ...
-
bioRxiv - Microbiology 2022Quote: ... and the other one was lysed for luciferase assay (40) using a commercial luciferase system (Promega). The luciferase activity in the test tubes was measured using a Turner BioSystems TD-20/20 Luminometer and reported as relative luciferase units (RLU ...
-
bioRxiv - Neuroscience 2023Quote: ... 100 microliters of CellTiter 96® AQueous One Solution Cell Proliferation Assay solution (MTS, Promega G3580) prepared in DMEM + 5% FBS was added to each well ...
-
bioRxiv - Cancer Biology 2023Quote: Cell growth was monitored using Cell Titer 96 AQueous One proliferation assay (MTS) (Promega, Madison, WI) as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Cell viability was assessed using the CellTiter 96 Aqueous One Solution Cell Proliferation Assay Kit (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Zoology 2024Quote: One-step RT-qPCR was conducted using GoTaq 1-Step RT-qPCR System kit (Promega, France) in total reaction volume of 20 µl containing 2 µl of RNA extracts and 300 nM of the same forward and reverse primers as above ...
-
bioRxiv - Neuroscience 2024Quote: ... Firefly luciferase activity was quantified using the ONE-Glo™ EX Luciferase Assay System (Promega, E8130) and read with the Synergy NEO2 multimode reader (BioTek) ...
-
bioRxiv - Molecular Biology 2023Quote: ... One-step RT-qPCR was performed using the GoTaq 1-Step RT-qPCR System (Promega, #A6020) and MicroAmp Fast Optical 96 Well Reaction Plates (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2023Quote: ... firefly luciferase activity was determined by using the One-Glo reagent according to manufacturer’s recommendations (Promega). The results were then normalized to SCR.
-
bioRxiv - Genetics 2024Quote: ... One µg of total RNA was reverse-transcribed by using the ImProm-ⅡTM Reverse Transcriptase (Promega). Three types of primers were used for the reverse transcription reaction ...
-
bioRxiv - Genomics 2019Quote: ... The product was amplified 12∼14 cycles and beads size selected (ProNex Purification System, Promega) before being sequenced in NextSeq 500 machines in a mid-output 150 bp cycle run.
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Molecular Biology 2019Quote: ... The siRNA target sequence was mutated from 5’-AGACCTAAGTTCTGTCGAA-3’ to 5’-CGGCCGAAATTTTGCAGGA-3’ and integrated into the pCI (Promega, E1731) plasmid for ectopic protein expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR analysis of XBP1 splicing was carried out using: XBP1 F 5’-GGAGTTAAGACAGCGCTTGGGGA-3’ and XBP1 R 5’-TGTTCTGGAGGGGTGACAACTGGG-3’ oligonucleotides and GoTaq® Green Master Mix (Promega), using a 58⁰C annealing temperature for 25 cycles ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... CellTiter 96 AQueous One Non-Radiactive Cell Proliferation Assay based on 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) was from Promega (Duebendorf, Switzerland). COmplete™ EDTA-free protease inhibitor cocktail was obtained from Roche Diagnostics (Mannheim ...
-
bioRxiv - Biophysics 2019Quote: ... The N-terminal Halo-tagged vector segment was cloned by using the primer sets: 5’-GAGTAACTAGCATAACCCCTTGGC-3’ and 5’-CACTAGCCATGTTATCGCTCTGAAAGTACAGATC-3’ with the pHTN HaloTag® CMV-neo Vector (Promega) as template ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... DDX60 (Fw 5’- AAGGTGTTCCTTGATGATCTCC-3’ Rv : 5’ -TGACAATGGGAGTTGATATTCC-3’) as analyzed by semiquantitative PCR using the SYBR Green assay GoTaq® qPCR Master Mix (Promega) with standardized primers (Metabion) ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... ATRX 5’-TGAAACTTCATTTTCAACCAAATGCTC-3’ and 5’-ATCAAGGGGATGGCAGCAG-3’ All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Neuroscience 2023Quote: ... 10 µL of 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) reagent (#G3582; Promega, Madison, WI) was added and incubated at 37°C for 45 mins ...
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’int-F and 24nt-6stp-R primers and 2) 3’KI: 24nt-6stp-F and 3’int-R using the GoTaq DNA polymerase mix (Promega, Madison, WI) and 200 nM of each primer ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Neuroscience 2021Quote: Neuronal transfections were performed on DIV 7 using a calcium phosphate kit (ProFection Mammalian Transfection System, Cat # E1200, Promega), based on a previously described method (Sando et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... For phospho-peptide samples the volume was increased to 2,000 μl (7-fold dilution) and 30 μg Trypsin Gold (Promega) was added to each sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... selected fragments of alternatively spliced exons (Supplementary Table 7) were cloned into the pGEM®-T Easy Vector (Promega). To generate the DNA templates for transcription ...
-
bioRxiv - Immunology 2023Quote: Transient transfection was performed using 1 or 2 µg plasmid DNA and 3.5 or 7 µl FuGENE HD transfection reagent (Promega) per 5x 105 cells ...
-
bioRxiv - Microbiology 2020Quote: ... 10 μL containing 3 units of DNase I (Promega) and 1 μL of CaCl2 was added ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-cleaved Caspase-3 (1:500 dilution, Promega), mouse anti-GFP (1:1,000 dilution ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 ng/μL trypsin (Trypsin Gold, V5280, Promega, USA), 0.01 % enhancer (ProteaseMAX™ ...
-
bioRxiv - Cancer Biology 2023Quote: ... For the Caspase-Glo 3/6 Assay (Promega #G8092), Caspase-Glo 3/7 reagent was added to the cells ...
-
bioRxiv - Immunology 2024Quote: ... IVT mRNA (3 pmol) and 10U RNase inhibitor (Promega) were then added to the cell suspension ...
-
bioRxiv - Cell Biology 2024Quote: ... for 3 h and with trypsin (1:25, Promega) for 16 h both at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... One μg of RNA was reverse transcribed into single stranded cDNA (Go Script Reverse Transcription System, Promega) and subsequently used for qPCR analyses on a Step One Plus real time PCR detection system (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2019Quote: ... CellTiter 96® AQueous One Solution Cell Proliferation Assay and CellTiter-Glo 3D Cell Viability Assay (Promega) were conducted according to the manufacturer’s instructions ...