Labshake search
Citations for Promega :
6151 - 6200 of 8279 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... the cells were lysed with Passive Lysis Buffer and the Nluc and Fluc activities were measured using the Nano-Glo Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The luciferase activity was detected directly from the infected cell monolayers using the Nano-Glo® Luciferase Assay System (Promega Corporation, Madison, USA) and the GloMax®-Multi Detection System as described above ...
-
Integrative Omics reveals genetic basis and TaMYB7-A1’s function in wheat WUE and drought resiliencebioRxiv - Plant Biology 2024Quote: ... the Firefly luciferase (LUC) and Renilla luciferase (REN) activities were measured using Dual-Glo® Luciferase Assay System (E2940, Promega Biotech Co., Ltd). Fluorescence signals were quantified using the dualLLUC assay reagent (MOLECULAR DEVICES ...
-
bioRxiv - Bioengineering 2024Quote: LDH levels in the chip basal effluents collected at 48 h post infection was analyzed as a secondary measurement of cell deaths using CytoTox 96® Non-Radioactive Cytotoxicity Assay (G1780, Promega, Madison, WI) following manufacturer’s instruction.
-
bioRxiv - Cancer Biology 2024Quote: ... cell viability was determined by using CellTiter-Glo® Luminescent Cell Viability Assay according to the manufacturer’s protocol (#G7572, Promega Corporation, Madison, WI).
-
bioRxiv - Immunology 2022Quote: Lung Lin-cells of infant and adult sepsis-surviving animals were isolated and the total DNA was extracted using a commercial kit (Wizard® Genomic DNA Purification Kit, Promega) according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2024Quote: DNA has been extracted from patient blood cell samples for HLA Class I typing using the DNA Isolation Kit (Wizard HMW DNA Extraction Kit from Promega, GER). DNA was used for Luminex-based high-definition LABType rSSO typing (One Lambda ...
-
bioRxiv - Cancer Biology 2024Quote: DNA has been extracted from patient blood cell samples for HLA Class I typing using the DNA Isolation Kit (Wizard HMW DNA Extraction Kit from Promega, GER). DNA was used for Luminex-based high definition LABType rSSO typing (One Lambda ...
-
bioRxiv - Developmental Biology 2022Quote: ... At T72h cell viability of both CT and SCT cultures was assessed via the CellTiter-Fluor cell viability assay (Promega Corporation, Madison WI, USA) as per manufacturer’s instructions.
-
bioRxiv - Bioengineering 2021Quote: ... we measured the release of lactate dehydrogenase (LDH) into the media effluents using the CytoTox 96® Non-Radioactive Cytotoxicity Assay (G1780, Promega GmbH, Walldorf, Germany). The assay was performed in a 384-well plate according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... BXPC-3 and CAPAN-1 pancreatic cancer cells treated with UR214-9 was measured using the Cell Titre96R Aqueous One Solution Cell Proliferation Assay (Promega Corp., catalog number: G3580) following the procedure published earlier ...
-
bioRxiv - Plant Biology 2021Quote: ... and the activities of Firefly luciferase and Renilla luciferase were determined using the Dual-luciferase® reporter assay system from Promega (cat. no. E1910). The LUC activity was calculated by normalising Firefly luciferase values with Renilla luciferase and was presented as relative luciferase values.
-
bioRxiv - Immunology 2021Quote: ... Luminescence was measured after 21 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega, Cat. Nr.: G7018 and G9995).
-
bioRxiv - Immunology 2020Quote: Cell viability upon treatment with auranofin and/or BSO was measured using the CellTiter 96®Non□Radioactive Cell Proliferation Assay (MTT) (Promega; Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... After a migration time of 4 h at 37°C (5 % CO2) lower compartment were analyzed for cell content by Cell-Titer-Glo® assay (Promega, Madison, WI, USA). Percentages of migrated cells were calculated as described before45 and normalized to the CXCL12-only control.
-
bioRxiv - Cell Biology 2022Quote: The number of viable cells inside HTM hydrogels subjected to the different treatments for 10 days was quantified with the CellTiter 96® Aqueous Non-Radioactive Cell Proliferation Assay (Promega; Thermo Fisher Scientific) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Cytotoxicity was evaluated by quantification of lactate dehydrogenase (LDH) release in cell cultures using CytoTox 96 nonradioactive cytotoxicity assay (Promega, Charbonnières-les-Bains, France) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... stored at 4°C and assayed the following day for lactate dehydrogenase (LDH) activity as a measure of cell death using a Cytotox 96® Non-radioactive Cytotoxicity Assay (Promega, Madison, Wisconsin, USA).
-
bioRxiv - Microbiology 2023Quote: ... Cytotoxicity was evaluated by quantification of lactate dehydrogenase (LDH) release in culture supernatant of transfected-cells using CytoTox96 nonradioactive cytotoxicity assay (Promega, Charbonnières-les-Bains, France) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: Activation of chemokine receptors was detected by measuring ß-galactosidase activity using the commercially available Beta-Glo assay system (Promega Corp, Madison, WI, USA) and luminescence signal was recorded on a multimodal plate reader (Enspire 2300 ...
-
bioRxiv - Microbiology 2023Quote: ... the infectivity of these pseudotyped viruses was determined by measuring luciferase activity using the PicaGene BrillianStar-LT Luciferase Assay System (TOYO B-Net Co., Ltd., Tokyo, Japan) and GloMax Navigator System G2000 (Promega Corporation, Madison, WI, USA) or by observing EGFP expression under a fluorescence microscope (IX71 ...
-
ADEVO: Proof-of-concept of Adenovirus Directed EVOlution by random peptide display on the fiber knobbioRxiv - Bioengineering 2023Quote: ... Media was changed at 3 hpi and luciferase luminescence was measured at 24 hpi using the Nano-Glo® Luciferase Assay (Promega, Madison, USA, #N1130) kit ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Cell viability was assessed by measuring the relative intracellular ATP levels using the CellTiter-Glo Luminescent Cell viability assay (Promega, Charbonnières-les-Bains, France). After treatment with pesticides ...
-
bioRxiv - Microbiology 2024Quote: ... The luciferase activity expressed by the recovered sporozoites was assessed (three replicates for each sample) using the Nano-Glo® Luciferase Assay System (Promega Corporation, Madison, USA). The sporozoites were mixed (v/v ...
-
bioRxiv - Biophysics 2024Quote: ... the viability of the treated and non-treated A549 spheroids was assessed using the CellTiter-Glo® 3D Cell Viability Assay (Promega, Madison, WI, USA) according to the manufacturers’ instructions.
-
bioRxiv - Cancer Biology 2024Quote: ... DNA was extracted from FFPE blocks using either the Qiagen AllPrep® DNA/RNA FFPE kit for FFPE-derived samples or using the Maxwell® RSC FFPE Plus DNA Kit (Promega). For frozen blocks ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines were authenticated using genomic DNA extracted with Puregene Gentra Kit and multiplexed using the Promega Geneprint Kit and multiplexed with a STR-based method (Promega Geneprint System). Samples were run on an Applied Biosystems 3130xl DNA analyser and the results analysed using the Applied Biosystems Genemapper v4.1 software ...
-
bioRxiv - Molecular Biology 2023Quote: ... the RNA/Protein Purification Plus kit (Norgen, Thorold, ON, Canada) or the Maxwell 16 LEV simplyRNA purification kit (Promega, Madison, WI, USA) according to the manufacturers’ instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was synthesized with the ImProm II Kit (Promega). qPCR was performed using the Brilliant III Ultra-Fast SYBR® Green QPCR Master mix reagents (Agilent Technologies ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized with a reverse-transcriptase kit (Promega). RNA of cells exposed to SARS-CoV-2 WT was isolated with the QIAamp Viral RNA Mini Kit (Qiagen ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... luciferase signal was quantified using the DualGlo kit (Promega). Each experiment was performed in triplicate with two biological replicates ...
-
bioRxiv - Molecular Biology 2020Quote: ... was subjected to poly(A)+tract isolation kit (Promega). Poly(A)+ enriched RNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... According to the instructions of the detection kit (Promega), the cells were transfected with the luciferase reporter gene level plasmid ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized using the Reverse Transcription kit (Promega). Transcriptional levels of IFN-β ...
-
bioRxiv - Biochemistry 2020Quote: ... The pGEM-T Vector kit was purchased from Promega. Acrylamide/bisacrylamide (29:1 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... using the Wizard® Genomic DNA Purification Kit (Promega). The kit can be used for at least 100 isolations ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using the Maxwell 16 LEV Plant DNA Kit (Promega), with EcoR1 as the restriction enzyme for generating RAD-seq libraries ...
-
bioRxiv - Cancer Biology 2021Quote: FGFR1 kinase enzyme system kit was purchased from Promega Inc ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell lines were authenticated using the GenePrint10 kit (Promega) and matching to their original profiles (ATCC) ...
-
bioRxiv - Cell Biology 2021Quote: ... we used the CellTiter-Glo® Luminescent kit (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... or Maxwell® 16 LEV Plant RNA Kit (Promega). cDNA was synthesized using Primescript II 1st Strand cDNA Synthesis Kit (Takara ...
-
bioRxiv - Plant Biology 2021Quote: ... using the Maxwell 16 LEV Plant RNA Kit (Promega). RNA was quantified using a NanoDrop (Thermo Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesized using MMLV reverse transcriptase kit (Promega) according to the manufacturers’ protocol with random primers (Promega) ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA was extracted using the Wizard Kit (Promega), as stated above ...
-
bioRxiv - Microbiology 2021Quote: ... The Wizard genomic DNA purification kit (Promega, Madison, WI) was used for isolation of bacterial genomic DNA (gDNA) ...
-
bioRxiv - Cell Biology 2020Quote: A GenePrint 10 System PCR Amplification kit (Promega Corporation) was used to determine the genetic signature of both samples based on the multiplex analysis of 9 loci and the Amelogenin sex-determining marker ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA synthesised (AMV Reverse Transcriptase kit, Promega, Southampton, UK) and amplified with primers CUE8cDNA-F (CACCATGGCTAACGAAGAACTCAC ...
-
bioRxiv - Microbiology 2022Quote: ... with the Maxwell® RSC Blood DNA kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was synthesized using the reverse transcription kit (Promega) and transcriptional expression of IFIT1 (Fw ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA synthesis was done with reverse transcription kit (Promega) using 50ng of total RNA ...