Labshake search
Citations for Promega :
5551 - 5600 of 6667 citations for Osteopontin Human OPN ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The relative light unit value of luciferase was determined using the PicaGene Luminescence Kit (TOYO B-Net Co., Ltd., Tokyo, Japan) and GloMax Navigator System G2000 (Promega Corporation, Madison, WI), according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2023Quote: ... DNA was purified from the samples using the Maxwell 16 Tissue LEV Total RNA purification Kit custom-adapted for DNA extraction (cat no. AS 1220, Promega, Madison, Wisconsin, USA) in a Maxwell 16 MDx instrument (Promega) ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR products were extracted from 2% agarose gel and purified using the AxyPrep DNA Gel Extraction kit (Axygen Biosciences, Union City, CA, USA) according to the manufacturer’s instructions and quantified using Quantus™ Fluorometer (Promega, Madison, WI, USA). The Illumina MiSeq platform (Illumina Inc. ...
-
bioRxiv - Developmental Biology 2023Quote: ... DNAs were purified using the PureYield Midiprep kit and were linearized before in vitro synthesis of anti-sense RNA probes using T7 or Sp6 polymerase (Promega, #P2077 and #P108G), RNAse inhibitor and dig-labeled rNTPs (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: ... and transferred to 96-well black plate to be treated with LARII and Stop & Glo components according to protocol of the Dual-Luciferase® Reporter Assay Kit (Promega CN: E1910). Luminescence was measured using a microplate reader (TECAN infinite M200pro) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Authentication of cell lines was confirmed regularly by short tandem repeat (STR) profiling by using the GenePrint 10 kit (Promega, Madison, WI, USA) on an ABI 3730 DNA analyzer (Applied Biosystems ...
-
bioRxiv - Physiology 2023Quote: ... coronary effluent was collected for detection and quantification of lactate dehydrogenase (LDH) using the Promega luminescent LDH-Glo 105TM Cytotoxicity Assay kit following manufacturer protocol (Promega, Madison, WI, USA).
-
bioRxiv - Physiology 2023Quote: Glutathione content was measured under normoxic conditions and after exposure to 30 min and 6 h hypoxia using the GSH-Glo Assay Kit (Promega, Madison, WI, USA) according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2023Quote: gDNA extraction from formalin-fixed paraffin-embedded (FFPE) tissue sections was carried out using Maxwell 16 FFPE plus LEV DNA purification kit (AS1720; Promega, Madison, WI, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... was reverse transcribed with a GoScriptTM Reverse Transcriptase cDNA reverse transcription kit according to the manufacturer’s instructions (Promega Corporation, an affiliate of Promega Biotecnologia do Brasil, Ltda). Primers were designed and synthesized by IDT-DNA (San Diego ...
-
bioRxiv - Microbiology 2023Quote: ... globosa gut isolates (KCTC 37188 and KCTC 37189) and skin isolates (KCTC 27541 and KCTC 27777) was extracted using the Wizard HMW DNA Extraction Kit (Promega, Madison, WI, USA), according to the manufacturer’s recommendations ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... senegalensis DNA was extracted from muscle tissues in thoraxes using Maxwell® 16 LEV Plant DNA Kit (Cat. No. AS1420, Promega, WI, USA). Details on extraction and library preparation protocols are provided in the Supporting Text 1.
-
bioRxiv - Microbiology 2024Quote: ... for intra-subcellular (i.e., vacuolar) conversion of glutamine (Gln) to glutamate (Glu) assay using Glutamine/Glutamate-Glo Assay kit (Promega, Madison, WI; Cat. # J8021) following kit’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... Luciferase activities were conducted 24 hours after transfection in the cells treated with or without the TEAD inhibitor CP1 using the dual-luciferase reporter kit (cat. E1910, Promega, Madison, WI, USA). Assays were conducted in triplicates and quantified using PerkinElmer EnVision plate reader ...
-
bioRxiv - Cell Biology 2024Quote: ... BP1425-500) at 37 °C and the plasmid was isolated from single colonies using the PureYield Plasmid Midiprep kit (Promega, Cat no. A2495), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The amplified product was used as a template to synthesize dsRNA using a RiboMAX Large Scale System-T7 Kit (Promega, Madison, WI, USA). The dsRNA was then isolated and purified ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we digested tissues using Proteinase K enzyme and used a Maxwell® Rapid Sample Concentrator Instrument with Maxwell® 16 Tissue DNA Purification Kit (Promega Corporation). We used 34 cycles polymerase chain reaction (PCR ...
-
bioRxiv - Biophysics 2020Quote: CosM6 cells were transfected with ∼1 µg of wild type or mutant constructs using FuGENE6 (Promega) and were patched within 1-2 days after transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized from 1 μg of each RNA sample using Oligo(dT)15 Primer (Promega) and M-MLV Reverse Transcriptase (RNase H Minus ...
-
bioRxiv - Microbiology 2021Quote: ... 1 µL cDNA was used as template for 25 cycles of PCR using GoTaq polymerase (Promega) targeting the TMV replicase using forward primer 5’ CCGCGAATCTTATGTGGAAT 3’ and reverse primer 5’ TCCTCCAAGTGTTCCCAATC 3’ ...
-
bioRxiv - Microbiology 2021Quote: ... A 1:10 solution of sample homogenate to colentrazine was analyzed on a GloMax Explorer (Promega).
-
bioRxiv - Neuroscience 2022Quote: ... using 0.5 - 1 μg of cDNA and FuGene as per the manufacturer’s instructions (Promega, Madison, WI). Cells were fixed for immunocytochemistry 24 or 48 h after transfection ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1.33 μL 1 M Tris-HCL pH 8.5 and 7.8 μL 0.5 mg/mL trypsin (Promega) were added and proteins left to digest for 16 hours at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were diluted with 875uL of 50mM Tris buffer along with Trypsin (1:100, Promega #V511C) for overnight digestion ...
-
bioRxiv - Molecular Biology 2021Quote: Primary antibodies and the dilutions used are as follows: anti-Halo (mouse, Promega G9211, 1:200); anti-Ezh2 (mouse ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 0 or 1 μg Sequencing Grade Modified Trypsin (0 or 10 μl; #V5111, Promega, WI, USA) that was reconstituted within trypsin re-suspension buffer (50 mM acetic acid ...
-
bioRxiv - Biochemistry 2019Quote: ... the sample was digested overnight at 37 °C with trypsin (1:200 w:w; Promega, Madison, WI). Peptides were desalted using a Sep-Pak (Waters ...
-
bioRxiv - Cell Biology 2019Quote: The primary antibody was incubated in 1× PBST (PBS + 0.1% Triton X-100) + 0.2% BSA (Promega) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNAs were diluted 1:5 and qPCR was performed using GoTaq® qPCR Master Mix (Promega). Primers for mCyb5r3 were ...
-
bioRxiv - Pathology 2020Quote: ... The extracted RNA (1 μg) was reverse-transcribed using Reverse Transcription System (Promega, Madison, Wisconsin, USA), and cDNAs were amplified using GeneAmp PCR System 9700 (Applied Biosystems ...
-
bioRxiv - Physiology 2019Quote: ... Plasmid DNA (6 µg) was mixed (1 : 3 ratio) with transfection reagent (Fugene 6; Promega, UK) in reduced serum media (OptiMEM ...
-
bioRxiv - Biochemistry 2019Quote: ... 20 μg of each sample was digested by adding 1 μg of sequencing grade trypsin (Promega) for 16 h at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... from the 1% TAE agarose gel and cloned into the pGEM-T Easy Vector System (Promega) for transformation ...
-
bioRxiv - Biochemistry 2021Quote: ... the membrane was imaged using 500 µl of 1:1000 NanoGlo substrate (Promega, catalogue number: N1120) diluted in 10 mM sodium phosphate buffer pH 7.0.
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were digested by incubation with sequencing-grade modified trypsin (1/50 w/w; Promega, V5113) for 12 h at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... One hundred nanograms of genomic DNA spiked with 1% (w/w) of unmethylated lambda DNA (Promega) was used for the library preparation ...
-
bioRxiv - Bioengineering 2021Quote: ... RNA (1 μg) was subjected to RT-PCR in accordance with the protocol provided by Promega. The transcripts were quantitated and normalized to the internal GAPDH control ...
-
bioRxiv - Cell Biology 2021Quote: ... The samples were digested overnight at 37°C with 1 μg trypsin (sequencing grade; #V5111, Promega) per 100 μg of protein.
-
bioRxiv - Microbiology 2020Quote: ... The cells were then lysed with 40 μL of 1× Cell Culture Lysis Reagent (Promega, E153A) for 40 minutes with shaking at 500 rpm ...
-
bioRxiv - Molecular Biology 2020Quote: ... at a 1:1000 dilution and a secondary antibody against rabbit coupled to HRP (Promega W4011) at a 1:20 000 dilution.
-
bioRxiv - Microbiology 2020Quote: ... cells were washed once with PBS and lysed in 40μl of 1 x CCLR buffer (Promega) for 10 min on a rocking plate at RT ...
-
bioRxiv - Microbiology 2021Quote: ... The infected cells were collected and lysed with 100 μl of 1× passive lysis buffer (Promega). The samples were sonicated for 30 seconds before centrifugation and 5 μl of the supernatants were collected for luciferase expression reading by the dual-luciferase reporter assay system (Promega ...
-
bioRxiv - Cell Biology 2021Quote: ... Promega standard protocol was used to synthesise cDNA from 1 μg RNA (Promega, Madison, Wisconsin, USA). Cripto ...
-
bioRxiv - Cell Biology 2021Quote: ... USA] and enzymatically proteolysed using trypsin/LysC (1:25 enzyme:protein ratio; V5072, Promega, Madison, WI, USA). Peptides from each sample were labelled using the ten-plex TMT reagent kit (90110 ...
-
bioRxiv - Neuroscience 2020Quote: ... all cells were incubated in the following: mouse anti-βIII tubulin (1:1000; 2 hr; Promega) and goat anti-mouse Alexa 546 (1:1000 ...
-
bioRxiv - Immunology 2022Quote: ... Proteins were digested into peptides with 12μL of 1:10 Trypsin Gold (Promega, Madison, Wisconsin, V528A) in 50mM TEAB per sample ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA synthesis was prepared with 1 µg of RNA using an AMV reverse transcription system (Promega) and random primers according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were digested by incubation with sequencing-grade modified trypsin (1/50 w/w; Promega,V5113) for 12 h at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK-293 cells were transfected with pmirGLO Dual-Luciferase miRNA Target Expression Vector (1 μg, Promega) containing a control reporter gene Renilla luciferase (hRluc ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μg of genomic DNA from the corresponding isolates was digested by EcoRI (Promega, Madison, WI), the amplified DNA fragments were subjected to ethanol precipitation (65) ...