Labshake search
Citations for Promega :
451 - 500 of 4762 citations for 7 bromo 1 methyl 1 3 dihydro 2H benzo d imidazol 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... 1 mL of warm (37-40°C) 2% agarose low-melting point (Promega® Cat. V2111) was infused through the trachea into the lungs using a polythene tube with a 1.5 mm diameter (Portex Cat ...
-
bioRxiv - Microbiology 2022Quote: ... a one-fifth volume of CellTiter 96 AQueous One Solution Cell Proliferation Assay (G3580, Promega) was added to DMEM/Pen/Strep containing 2% FBS and incubated for 2 h ...
-
bioRxiv - Immunology 2020Quote: Viable cell numbers were quantified either by Trypan blue exclusion or by the production of formazan product (OD490) 2 hours after addition of CellTiter 96® Aqueous One Solution assay reagent (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were incubated for one hour at 47°C with 2 µg of sequencing grade trypsin (Promega, San Luis Obispo, CA) dissolved in 50 mM TEAB ...
-
bioRxiv - Bioengineering 2024Quote: One hundred micrograms of each antibody were reduced with 50 mM DTT and treated with 2 µl PNGase F (Promega, USA) at 37°C for over 16h with stirring before being transferred to a new vial for LC-MS analysis ...
-
bioRxiv - Genomics 2021Quote: ... 1 U μl−1 RNasein (Promega), 0.1% IGEPAL CA-630 (Sigma)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... the SCN cultures were maintained in a 35-mm petri dish with 1 mL culture medium containing 0.3 mM D-luciferin (Promega, Madison, WI, USA) at 36 °C ...
-
bioRxiv - Bioengineering 2023Quote: Mice were administered either 200μL of 15 μg/mL D-luciferin or a 1:40 dilution of Nano-Glo substrate (Promega, diluted in DPBS) by intraperitoneal injection for firefly luciferase and Antares or nanoluciferase imaging ...
-
bioRxiv - Cancer Biology 2021Quote: ... wild type or mutant 3′-UTR of DKK3 was cloned into the psicheck-2 vector (Promega). HCT116 cells were transfected with and wild-type or mutant 3′-UTR-luc by using Lipofectamine 3000 ...
-
bioRxiv - Plant Biology 2021Quote: ... 2-3 μg of the purified RNA was in vitro translated using wheat germ extract (Promega) at 25 °C for 2 h as per the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... Cytotoxicity was measured using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide (MTT) assay kit (Promega) by determining Formazan absorbance at 590 nm on a Tecan Safire automated plate reader ...
-
bioRxiv - Microbiology 2023Quote: The genes were cloned one by one into in pGEM-T Easy Vector (Promega, Madison, USA) and finally in pMG36e vector (Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μL RRV-P3 plasmid or 3 μL of cDNA from rose tissue or nuclease-free water (Promega, Madison, WI). The final volume of the LAMP reaction was 25 μL.
-
bioRxiv - Immunology 2021Quote: ... JEG-3 viability after 1 h salubrinal pretreatment followed by 48 h ZIKV infection was measured by CellTiter-Glo Assay (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... The cells were then washed three times with 1 × PBS and blocked with 3% Blot-Qualified bovine serum albumin (BSA, Promega) in 1 × PBS containing 0.05% Tween-20 (TPBS ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the pSARP-12R4-9 input library with a 3:1 transfection reagent:DNA ratio using Fugene 6 transfection reagent (Promega #E269A). At 72 hrs ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA-TBST for 1h at room temp ...
-
bioRxiv - Molecular Biology 2022Quote: ... The SELENOP 3’UTR and the control plasmid were linearized using Bsb 1 and in vitro transcribed using the Ribomax kit (Promega). The RNA was then purified using p30 size exclusion columns (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... The cytotoxicity of compounds (100 uM to 1 uM, 3-fold dilution) was examined using the CellTiter-Glo Luminescent Cell Viability Assay (Promega). Cell cytotoxicity data was normalized to DMSO control as 0% cell death.
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were washed 3 times for 10 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 5% non-fat dry milk -TBST for 1 h at RT ...
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ObLiGaRe-TLR construct was co-transfected with Zinc Finger Nuclease (ZFN)-AAVS1 plasmid in a 1:3 ratio using FuGENE transfection reagent (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... We co-transfected cells with the Tol2 GIV transposon and a Tol2 transposase (Vector Builder) at a 3:1 ratio of micrograms of plasmid DNA using Fugene 6 (Promega) according to the manufacturer’s directions ...
-
bioRxiv - Microbiology 2023Quote: ... For transient expression experiments each well was transfected with 100 ng of DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Twenty-four hours after transfection or doxycycline stimulation ...
-
bioRxiv - Biophysics 2023Quote: ... Bacmids for the wild type and all Xl-HAS-1 mutants were purified from 3 white colonies and transfected into Sf9 cells at 1×106 cells/mL using the FuGene reagent (Promega). Cells were maintained in ESF921 medium (Expression Systems ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA -TBST for 1h at room temp ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfection was performed with 1 μg of plasmid DNA in combination with 3 μL of Fugene HD transfection reagent per well (Promega).
-
bioRxiv - Microbiology 2023Quote: For NanoBIT experiments 12,000 HeLa cells were seeded in 96-well black plates and each well was transfected with 100 ng of total DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Different amounts of plasmid DNA were used to achieve comparable expression of LgBiT/FLAG-tagged and SmBiT/V5-tagged proteins ...
-
bioRxiv - Genomics 2024Quote: ... Reverse transfection was done using a ratio 3:1 volume-to-mass ratio of FuGENE6 (0.3 µL reagent: 100 ng of DNA per well, Promega E2691). The transfection mix included the following vectors ...
-
bioRxiv - Cell Biology 2024Quote: ... protein samples were then incubated with chymotrypsin at a ratio of 1:80 (enzyme to protein) for 3-4 h at RT and then trypsin (Promega) at a ratio of 1:80 (enzyme to protein ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were seeded onto acid-washed coverslips to ensure surface cleanliness and cell adherence at a density of 3 × 104 cells per coverslip for 24 h before transfection with 1 μg of plasmid DNA using 3 μL Fugene HD transfection reagent (Promega). HaloTagged AP2-σ2 was visualized by adding the JF646-HaloTag ligand (Promega) ...
-
bioRxiv - Cancer Biology 2021Quote: ... MTS reagent (CellTiter96 AQueous One; Promega) was added and the optical density was read at 490 nm to assess viability.
-
bioRxiv - Systems Biology 2020Quote: ... ONE-GloTM Luciferase Assay System (Promega) and Renilla-Glo® Luciferase Assay System (Promega ...
-
bioRxiv - Immunology 2024Quote: ... 40 μL of One-GloEX (Promega) was added to the cells and incubated in the dark for 5 min prior to reading on an Agilent BioTek Neo2 plate reader ...
-
bioRxiv - Biochemistry 2024Quote: ... 40 μL of One-GloEX (Promega) was added to the cells and incubated in the dark for 5 min prior to reading on an Agilent BioTek Neo2 plate reader ...
-
bioRxiv - Molecular Biology 2022Quote: ... using QuantiFluor ONE Lambda DNA (Promega) as a DNA standard ...
-
bioRxiv - Molecular Biology 2022Quote: ... or QuantiFluor ONE dsDNA System (Promega) using QuantiFluor ONE Lambda DNA (Promega ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... one volume of CellTiter-Glo (Promega) assay reagent was added to each well ...
-
bioRxiv - Microbiology 2023Quote: One step RT-PCR kit (Promega) was used ...
-
bioRxiv - Genetics 2023Quote: ... One microgram of Trypsin Gold (Promega) was added to each sample and incubated in an end-over-end mixer at 37°C for 16 hours ...
-
bioRxiv - Developmental Biology 2023Quote: ... The QauntiFluor ONE dsDNA System (Promega) is used to quantify the double stranded library ...
-
bioRxiv - Cell Biology 2023Quote: ... 2.5 units of RNase ONE (Promega) was added to the sample ...
-
bioRxiv - Cancer Biology 2024Quote: ... and One Glo Luciferase Assay (Promega). Luminescence was quantified using a Synergy NEO (BioTek multi-mode plate reader) ...
-
bioRxiv - Biophysics 2021Quote: ... the cells were transfected with 1 – 2 μg EphA2-mTurquoise plasmid DNA using FuGene HD (Promega, #E2311) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... urea was diluted to 1 M by adding 50 mM ammonium bicarbonate and 2 μg Trypsin (Promega) per 100 μg protein ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 μg of GST-tagged effector proteins and 2 μl of FluoroTect™ GreenLys tRNA (Promega, USA) were gently mixed with High-Yield Wheat Germ Master Mix ...