Labshake search
Citations for Promega :
451 - 500 of 1522 citations for 5 Methylsulfamoylmethyl 1H indole 3 carboxylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2024Quote: ... The digested samples were combined with 5 μL of 6 x 5 LC-MS/MS Peptide Reference mix (Promega) and stored at-20℃ until analysis.
-
bioRxiv - Synthetic Biology 2020Quote: ... that was reconstituted within trypsin re-suspension buffer (50 mM acetic acid; #V542A, Promega, WI, USA), and 39 μl or 49 μl 250 mM Tris buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... Ethylenediaminetetra-acetic acid (EDTA, 0.5 M, pH 8.0) and trypsin were purchased from Promega (Madison, WI). Lysyl endopeptidase (Lys-C ...
-
bioRxiv - Biochemistry 2021Quote: ... precipitated by trichloroacetic acid precipitation and digested with 1:50 (w/w) chymotrypsin (Promega, Cat #V106A) in 100 mM Tris-HCl and 10 mM CaCl2 for 18 h at 37 °C with shaking ...
-
bioRxiv - Genomics 2021Quote: ... in a QIACube extractor or with Maxwell® RSC Viral Total Nucleic Acid Purification Kit (Promega) in a Maxwell® RSC instrument following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: The Maxwell® RSC Viral Total Nucleic Acid Purification Kit (cat. # ASB1330, Promega Corporation, Maddison, WI) was used to isolate RNA as instructed by the manufacturer ...
-
bioRxiv - Cancer Biology 2022Quote: The sequence encoding RARα LBD (amino acids 176-421) was cloned into pBIND vector (Promega E245A) to generate pBIND-RARα LBD ...
-
bioRxiv - Microbiology 2022Quote: Viral RNA was extracted from plasma using the Viral Total Nucleic Acid Kit (Promega, Madison, WI) on a Maxwell 48 RSC instrument (Promega ...
-
bioRxiv - Immunology 2024Quote: ... viral RNA was isolated using the Maxwell Viral Total Nucleic Acid Purification Kit (Promega, Madison, WI) and reversed transcribed using the TaqMan Fast Virus 1-Step qRT-PCR Kit (Invitrogen) ...
-
bioRxiv - Molecular Biology 2024Quote: 6.5 µl of translation-competent extracts were freshly supplemented with 0.4 mM amino acids (L4461, Promega), 15 mM HEPES pH 7.3 ...
-
bioRxiv - Molecular Biology 2020Quote: ... of selected 3’UTRs into the pmirGLO vector (Promega, Southampton, UK) was used to generate 3’UTR luciferase reporters essentially as previously described (9) ...
-
bioRxiv - Biochemistry 2020Quote: ... Each well was transfected with 3 uL FuGENE 6 reagent (Promega) and 130 ng pcDNA3-mouseSTING in line with manufacturer’s protocols.
-
bioRxiv - Microbiology 2021Quote: ... 3 μg of total RNA was treated with RQ1 DNase (Promega), and then purified by phenol chloroform extraction and ethanol precipitation ...
-
bioRxiv - Cancer Biology 2020Quote: ... Apoptosis was determined using Caspase 3/7-Glo assay kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... freshly add 3 µL 1:1 water diluted digitonin (Promega G9441)) was added ...
-
bioRxiv - Immunology 2021Quote: ... then each well was diluted 1:3 with TE buffer (Promega). A 2.7 μL aliquot from each sample was mixed with 2.5 μL of SsoFast EvaGreen Supermix with Low Rox (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... or 250 ng DNA (Nup54-mEGFP) and 3 µL FuGENE6 (Promega) in Opti-Mem I (Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... and a Victor 3 or GloMax Navigator luminometer (Perkin Elmer/Promega). The 50% and 80% inhibitory concentrations (IC50 and IC80 ...
-
bioRxiv - Immunology 2023Quote: ... (3) We used the ProNex Size-Selection DNA Purification System (Promega) to purify PCR products ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Samples from liquid culture were placed on 3% agarose pads (Promega) containing M9 minimal media and sandwiched between glass coverslips to immobilize the cells for imaging ...
-
bioRxiv - Biochemistry 2024Quote: ... using random primers and oligo-dT primers (3:1 mol) (Promega). The obtained cDNA was stored at −20 °C until further use.
-
bioRxiv - Cancer Biology 2023Quote: ... 100 µl/well of room temperature Caspase Glo 3/7 (Promega) reagent was added to the treated and control cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... we used Caspase-Glo 3/7 and 8 assay systems (Promega). Approximately 2.0 × 103 cells/well were seeded in a 96-well plate and (1 ...
-
bioRxiv - Systems Biology 2024Quote: ... 1 µg plasmid was combined with 3 µl FuGENE (Promega, E2311) in OptiMEM medium for each ml of culture medium ...
-
bioRxiv - Cancer Biology 2024Quote: Caspase activity was measured using Caspase-Glo® 3/7 (Promega) according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2024Quote: Apoptosis was measured using the Caspase-Glo 3/7 Assay (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega). The PCR product was cloned into the pGEM T-Easy vector (Promega) ...
-
Spatial 3D genome organization controls the activity of bivalent chromatin during human neurogenesisbioRxiv - Neuroscience 2024Quote: ... Sorted nuclei were collected in 5-ml tubes containing 300-500 μl of collection buffer (PBS + 5% BSA) and RNasin Plus RNase inhibitor (Promega). Sorted nuclei were collected by centrifuging at 500g for 10 min at 4°C and processed for downstream analyses (RNA-seq ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 µg/ml RNAsin (Promega, Cat#: N2511). The cells were collected through scraping and homogenised by pipetting ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL/mL RNasin Plus (Promega, cat. #N2611) was added 10 minutes before use ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 ng of Renilla luciferase report (Promega) were co-transfected into U87 human primary glioblastma cells by using ESCORT V transfection reagent (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 ng of pGL4.53(luc2/PGK) vector (Promega), 1 ng of pNL plasmid ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL Pfu DNA Polymerase 10X Buffer (Promega), 1 μL Pfu DNA Polymerase (Promega) ...
-
bioRxiv - Zoology 2020Quote: ... 10 μL 5× PCR buffer (Gotaq flexi, Promega), 8 μL 25mM MgCl ...
-
bioRxiv - Genomics 2020Quote: ... 5 x RT Improm II reaction buffer (Promega), 50 ng hexanucleotides ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... 5 μL of GoTaq qPCR Master Mix (Promega), and 250 nM primer (Supplementary Table S2) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μl NanoGlo substrate (Promega GmbH, Germany, #N1110) diluted 1:100 in the supplied lysis buffer and was mixed with the 50 μl culture in a white 96-well plate and bioluminescence was determined after 3 min incubation using an Orion II Microplate Luminometer (Berthold Technologies GmbH and Co ...
-
bioRxiv - Biophysics 2023Quote: ... 5 μL of NanoBiT Nano-Glo reagent (Promega N2012 ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl of 5x optimized transcription buffer (Promega), 2 µl of T7 RNA polymerase (20 U.ml-1) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and then 5 ng/μL of trypsin (Promega) was added and samples incubated over night at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM DTT with sequencing-grade trypsin (Promega) for one hour at room temperature with 1:800 or 1:1600 mass (w/w ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5 μl of DNase I (Promega, M6101) at 37 °C for 20 min ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng renilla control reporter vector (Promega), using TransIT-X2 transfection reagent (Mirus Bio ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 5 ng renilla control reporter vector (Promega), mock luciferase ...
-
bioRxiv - Genomics 2024Quote: ... lysed by a 5× reporter lysis buffer (Promega) and incubated overnight at −20°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 µM HaloTag PEG-biotin ligand (G859A; Promega) or an equivalent amount of DMSO was added ...
-
bioRxiv - Genomics 2020Quote: RNA was isolated via acid-phenol extraction.72 RNA was DNase treated with RQ1 DNase (Promega M6101) by addition of 5µL RQ1 buffer and 5µL RQ1 DNase to each RNA sample ...
-
bioRxiv - Plant Biology 2022Quote: Glutathione and Ascorbic acid content were quantified using the GSH-GLO Glutathione Assay Kit (Promega, Madison, USA) and Megazyme kit (K-ASCO 04/19 ...
-
bioRxiv - Microbiology 2020Quote: Genomic deoxyribonucleic acid (gDNA) was isolated from each mutant using the Wizard® gDNA purification kit (Promega). Illumina NextSeq was then performed by the Genomic Services Facility at Indiana University Center for Genomics and Bioinformatics ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was extracted using the Maxwell® RSC Viral Total Nucleic Acid Purification Kit (Cat# AS1330, Promega) or Maxwell® RSC miRNA from Plasma or Serum (Cat# AS1680 ...