Labshake search
Citations for BioLegend :
1801 - 1850 of 2016 citations for FITC labeled Fibrinogen since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... cells were washed and incubated with fluorescently labeled antibodies (CD4 PE, clone RM4-5, 1:400, BioLegend; CD8a FITC ...
-
bioRxiv - Immunology 2024Quote: ... to determine viability and subsequently labeled with anti-CD11b (M1/70, BV510-conjugated, 1:400, BioLegend 101263), anti-Ly6C (HK1.4 ...
-
bioRxiv - Bioengineering 2024Quote: ... Harvested DCs were then stained with an APC-labeled anti-mouse H-2Kb/SIINFEKL complex antibody (Biolegend). For in vivo studies ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were blocked using PBS/1% BSA/0.5% Tween-20 and incubated with monoclonal mouse FITC anti BrdU (Biolegend, clone 3D4) at 1:50 dilution for 20 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... After 48 h incubation, cells were collected and stained with anti-CD3-FITC (BioLengend, 300406) and anti-CD69-APC (BioLegend, 310910) for 30 min at 4 °C ...
-
bioRxiv - Bioengineering 2020Quote: ... cells were washed twice with wash buffer and then incubated with FITC-conjugated anti-cMyc antibody and PE-conjugated anti-human Fc (BioLegend, #342303) or PE-conjugated anti-Fab (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: Cells were harvested at the indicated times and co-stained with Annexin-V-FITC and propidium iodide following manufacturer instructions (BioLegend, #640914). To assess active Caspase-3 ...
-
bioRxiv - Cancer Biology 2020Quote: ... fixed and stained for intracellular Ki67 following BD Pharmingen’s procedure for FITC BrdU Flow Kit (Cat# 559619) with two modifications: DNase treatment step was omitted and Ki67-AlexaFluor488 (Biolegend #350507) was used instead of anti-BrdU FITC.
-
bioRxiv - Cell Biology 2021Quote: ... 25-4317-82) for HSC/MPP staining, or together with CD34-FITC (eBioscience, 11-0341-85) or CD34-biotin (BioLegend, 119304) and FcγR-PerCP-Cy5.5 (eBioscience ...
-
bioRxiv - Immunology 2022Quote: ... Every 10^6 B cells in 100 μL solution were then stained with 3 μL FITC anti-human CD20 antibody (BioLegend, 302304), 3.5 μL Brilliant Violet 421 anti-human CD27 antibody (BioLegend ...
-
bioRxiv - Immunology 2022Quote: ... 0.1% BSA/PBS 15 min on ice) and incubated with either FITC-anti-human CD3 (clone HIT3a; BioLegend, San Diego, CA) and PE-anti-human CD56/NCAM (HCD56 ...
-
bioRxiv - Neuroscience 2022Quote: ... The homogenates were first blocked in PBS with 10% rat serum with gentle rotation in a cold room and then stained for 1h protected from light at 4°C with CD206-FITC (cat no. 141704, Biolegend®) + MHCII-PE (cat no ...
-
bioRxiv - Immunology 2022Quote: ... Every 106 B cells in 100 μl solution were stained with 3 μl FITC antihuman CD20 antibody (BioLegend, 302304, clone: 2H7), 3.5 μl Brilliant Violet 421 antihuman CD27 antibody (BioLegend ...
-
bioRxiv - Immunology 2020Quote: ... was incubated with 1-2 spike+ cells for 1 hour at 4°C before adding of 0.02 ug/ml ACE2-mFc followed by FITC conjugated anti-mouse IgG (Biolegend, cat#405305) and the MFI of FITC and positive percentage were collected.
-
bioRxiv - Immunology 2021Quote: ... The frozen tissue sections were treated with blocking solution (5% normal donkey serum in PBS) and then stained with FITC-conjugated anti-Ly6G antibody (BioLegend, 1A8). Nuclei were stained by DAPI ...
-
bioRxiv - Immunology 2021Quote: ... human AB serum and were incubated on ice for 30 minutes with the following antibodies: CD66b-FITC (1:100, Biolegend 305104), EpCAM-PE (1:100 ...
-
bioRxiv - Bioengineering 2020Quote: ... Cells were washed twice with wash buffer and then incubated with FITC-conjugated anti-cMyc antibody and PE-conjugated anti-human Fc (BioLegend, #342303) or PE-conjugated anti-Fab (Thermo Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... Then the live microglial cells were incubated with PBS supplemented with 5% BSA + HLA-DR mouse monoclonal antibodies pre-conjugated with FITC (1:100, BioLegend, Inc.) + Hoechst 33342 (1:5000 ...
-
bioRxiv - Bioengineering 2024Quote: ... separate tubes were designated for FITC anti-human CD80 Antibody and APC/Cyanine7 anti-human CD206 (MMR) Antibody (BioLegend Europe B.V.) staining with an incubation time of 30 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... then incubated for 1 hr at 4°C with the following antibodies: CD26 (DPP4)-fluorescein isothiocyanate (FITC) (Biolegend, 137806; 1:200), anti-mouse ICAM1-phycoerythrin (PE)/Cy7 (Biolegend ...
-
bioRxiv - Microbiology 2023Quote: ... The following antibodies were used for flow cytometry analysis: FITC-conjugated anti-CD19 (6D5) (BioLegend, San Diego, CA, USA, cat# 115505), APC-conjugated anti-CD11b (M1/70 ...
-
bioRxiv - Biophysics 2023Quote: ... biotinylated anti-mouse CD3e (Cat# 100304) and FITC anti-mouse TCRb antibody (Cat# 109206) were purchased from BioLegend (San Diego, CA). Azide-PEG4-NHS ester (Cat# AZ103-100 ...
-
bioRxiv - Immunology 2023Quote: ... Reaction was stopped by centrifugation at 4°C and externalized LAMP1 (CD107a) was stained using FITC-coupled anti-LAMP1 antibody (clone 1D4B, BioLegend, #121605) for 20 minutes at 4°C in the dark ...
-
bioRxiv - Bioengineering 2023Quote: ... Nanovials were reconstituted at a ten-fold dilution in Washing Buffer containing 2 μL of 100 μg/mL anti-HLA-A2 FITC antibody (Biolegend, 343304) and incubated for 30 minutes at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... The digested tissue was resuspended in 100 μL of 4% FBS in PBS containing an FITC antibody to CD11b (1:100; BioLegend, 101206) and PE antibody to CD45(1:100 ...
-
bioRxiv - Cell Biology 2022Quote: ... Twenty four hours after irradiation cells were trypsinized and stained using the FITC Annexin V Apoptosis Detection Kit with PI (Biolegend, CA) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... The reaction was stopped by centrifugation at 4°C followed by staining of cell surface LAMP-1 (CD107a) using FITC-coupled anti-LAMP-1 antibody (clone 1D4B, BioLegend, #121605) for 20 minutes at 4°C in the dark ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cells were washed with autoMACS Running Buffer and stained with 100 µL per well of FITC Streptavidin (SA; #405202, BioLegend, USA) diluted 1:50 in autoMACS Running Buffer ...
-
bioRxiv - Developmental Biology 2023Quote: The flow cytometry staining for necrosis and apoptosis was was performed with the FITC Annexin V Apoptosis Detection Kit with 7-AAD (Biolegend, 640922). Once the cells were incubated in 10 µM of EdU ...
-
bioRxiv - Immunology 2023Quote: ... and labelled with anti-mouse TNF-ɑ (clone: Mab11, FITC), IFN-γ (clone: 4S.B3, BV-650) (BioLegend, San Diego, CA, USA), and GrzB (clone ...
-
bioRxiv - Immunology 2023Quote: ... 1x106 B cells in 100 μl buffer were incubated with a panel of antibodies including 3 μl FITC anti-human CD20 antibody (BioLegend, 302304), 3.5 μl Brilliant Violet 421 anti-human CD27 antibody (BioLegend ...
-
bioRxiv - Genomics 2024Quote: ... hfCas13 knockdown activity was confirmed by flow cytometry using APC anti-CD46 and FITC anti-CD55 (BioLegend 352405 and 311306, respectively). Monoclonal doxycycline-inducible RfxCas13d-NLS HEK293FT ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were washed twice with wash buffer and then incubated with FITC-conjugated anti-HA and PE-conjugated anti-human Fc (BioLegend, #342303) or PE-conjugated anti-Fab (Thermo Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were then washed with PBS and incubated for 30 min at 4 °C with the following antibodies resuspended in FACS buffer (DPBS with 1% FBS): anti-CD11b-FITC (BioLegend, #101205), anti-CD49f-PE (BD Bioscience ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were then washed with PBS and incubated for 30 min at 4 °C with the following antibodies resuspended in FACS buffer: anti-CD11b-FITC (BioLegend, #101205), anti-Gfap-AF647 (BD Bioscience ...
-
bioRxiv - Immunology 2024Quote: ... CD8 PE, MEM-31, Exbio #1P-207-T025; CD45RA FITC, MEM-56, Exbio #1F-223-T100; CCR7 PeCy7, G043H7, BioLegend #353226) and one of the hashtag antibodies (the same as in the initial experiment ...
-
bioRxiv - Cancer Biology 2024Quote: ... KRASG12D and KRASG12D/C185D were stained with FITC-Annexin V and 7-AAD following the instruction of the FITC-Annexin V Apoptosis Detection Kit with 7-AAD (BioLegend; # 640922) and the samples were run on a BD LSRFortessa cell analyzer.
-
bioRxiv - Microbiology 2021Quote: ... and then stained using fluorescent-labeled monoclonal antibodies as follows: Ly6G-BV421 (1:200, BioLegend, Cat No. 127627); CD45-FITC (1:200 ...
-
bioRxiv - Immunology 2020Quote: ... Fluorescence labeled antibodies (CD209,CD206 et al) and multi cytokines kit were from Biolegend (San Diego, CA, USA). Specific inhibitors were acquired from MedChemExpress (Monmouth Junction ...
-
bioRxiv - Cancer Biology 2022Quote: The cells used in this study were labeled with anti-human B7-H3 monoclonal antibody (Biolegend, clone MIH42) PerCP/Cyanine 5.5 conjugate at 4°C for 45 minutes in the dark ...
-
bioRxiv - Immunology 2022Quote: ... BioLegend) for 30min at 4 °C and intracellular markers (BV421-labeled anti-mouse IFN-γ, Cat# 505830, BioLegend; FITC-labeled anti-mouse IL-2 ...
-
bioRxiv - Microbiology 2022Quote: Single-cell suspensions were incubated and labeled with the following antibodies obtained from BioLegend (San Diego, CA, USA) at a 1:100 dilution ...
-
bioRxiv - Biophysics 2022Quote: ... the NMMIIA rods were labeled using 909801 anti-non-muscle-myosin IIA heavy chain primary antibody (Biolegend, rabbit) and Alexa 561 secondary (goat anti-rabbit).
-
bioRxiv - Immunology 2020Quote: ... BV510-conjugated anti-CD4 clone RM4-5 and PerCP-conjugated anti-CD8a clone 53-6.7 or Biotin-labeled anti-CD8 clone 53-6.7 (all BioLegend) were used ...
-
bioRxiv - Immunology 2020Quote: ... and Nlrp3-/- BMDMs were stained with anti-mouse MHC 1 Kb-PE labeled antibodies (BioLegend, clone AF6-88.5) and they were positive by FACS analysis.
-
bioRxiv - Immunology 2021Quote: ... Splenocytes from donor wildtype mice or from B2m-/- mice were labeled with carboxyfluorescein diacetate succinimidyl ester (CFSE, Biolegend) or with Tag-It Violet (Biolegend) ...
-
bioRxiv - Immunology 2022Quote: ... The samples purified in this way from each group of recipients were then suspended in 100μL buffer and labeled with 1μg per sample of the following Total-seq A antibodies from BioLegend: TotalSeq™-A0198 anti-mouse CD127 (A7R34) ...
-
bioRxiv - Immunology 2024Quote: ... and then stained for 30 minutes on ice with an APC-labeled antibody against CD3 (BioLegend; clone UCHT1), phycoerythrinCy7–labeled (PE-Cy7–labeled ...
-
bioRxiv - Immunology 2024Quote: ... Half of the fresh biopsies from each donor were labeled with TotalSeq-A0251 barcode sequence GTCAACTCTTTAGCG (Biolegend 394601), and the other half of the fresh biopsy sample was labeled with MULTI-seq lipid-tag barcode sequence CCTTGGCACCCGAGAATTCCAGGAGAAGA66 ...
-
bioRxiv - Immunology 2024Quote: ... Half of the cryopreserved biopsies from each donor were labeled with TotalSeq-A0252 barcode sequence TGATGGCCTATTGGG (Biolegend 394603), and the other half of the cryopreserved biopsy sample was labeled with MULTI-seq lipid-tag barcode sequence CCTTGGCACCCGAGAATTCCACCACAATG66 ...