Labshake search
Citations for BioLegend :
701 - 750 of 1018 citations for Myelin Basic Protein Biotin labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... The CD11c-APC-depleted fraction was further incubated with anti-biotin beads (Milteniy Biotec, cat# 130-090-485) and streptavidin-PE/Cy7 (BioLegend, 1:500), followed by another MACS enrichment using MS columns ...
-
bioRxiv - Developmental Biology 2020Quote: ... and labeled using a FITC Annexin V and propidium iodide staining kit as per manufacturer’s protocol (BioLegend, 640914). Both EdU- and Annexin V-labeled samples were analyzed on a LSRII flow cytometer (BD Biosciences ...
-
bioRxiv - Microbiology 2021Quote: ... and then stained using fluorescent-labeled monoclonal antibodies as follows: Ly6G-BV421 (1:200, BioLegend, Cat No. 127627); CD45-FITC (1:200 ...
-
bioRxiv - Immunology 2020Quote: ... Fluorescence labeled antibodies (CD209,CD206 et al) and multi cytokines kit were from Biolegend (San Diego, CA, USA). Specific inhibitors were acquired from MedChemExpress (Monmouth Junction ...
-
bioRxiv - Immunology 2021Quote: ... Germinal center B cells were labeled using rat anti-GL7 antibody (FITC; BioLegend, catalog no. 144604, 1:250). Tfh cells were labeled using anti-CD4 antibody (BioLegend ...
-
bioRxiv - Cancer Biology 2022Quote: The cells used in this study were labeled with anti-human B7-H3 monoclonal antibody (Biolegend, clone MIH42) PerCP/Cyanine 5.5 conjugate at 4°C for 45 minutes in the dark ...
-
bioRxiv - Immunology 2022Quote: ... BioLegend) for 30min at 4 °C and intracellular markers (BV421-labeled anti-mouse IFN-γ, Cat# 505830, BioLegend; FITC-labeled anti-mouse IL-2 ...
-
bioRxiv - Microbiology 2022Quote: Single-cell suspensions were incubated and labeled with the following antibodies obtained from BioLegend (San Diego, CA, USA) at a 1:100 dilution ...
-
bioRxiv - Biophysics 2022Quote: ... the NMMIIA rods were labeled using 909801 anti-non-muscle-myosin IIA heavy chain primary antibody (Biolegend, rabbit) and Alexa 561 secondary (goat anti-rabbit).
-
bioRxiv - Immunology 2020Quote: ... and Nlrp3-/- BMDMs were stained with anti-mouse MHC 1 Kb-PE labeled antibodies (BioLegend, clone AF6-88.5) and they were positive by FACS analysis.
-
bioRxiv - Immunology 2021Quote: ... Splenocytes from donor wildtype mice or from B2m-/- mice were labeled with carboxyfluorescein diacetate succinimidyl ester (CFSE, Biolegend) or with Tag-It Violet (Biolegend) ...
-
bioRxiv - Immunology 2022Quote: ... The samples purified in this way from each group of recipients were then suspended in 100μL buffer and labeled with 1μg per sample of the following Total-seq A antibodies from BioLegend: TotalSeq™-A0198 anti-mouse CD127 (A7R34) ...
-
bioRxiv - Immunology 2023Quote: ... and ST2 were determined by flow cytometric analyses using FITC-labeled anti-mouse FcεRIα (clone MAR-1, BioLegend), APC-labeled anti-mouse CD117 (clone 2B8 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Washed cells were stained with two fluorescently labeled epitope tag-specific antibodies (anti-FLAG PE, Biolegend, cat# 637309), anti-HA Alexa 647 ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were labeled with an antibody cocktail containing Anti-CD14-PE/Cy7 (Clone 63D3, 367111, BioLegend, 1:100), Anti-CD80-APC (Clone 2D10 ...
-
bioRxiv - Developmental Biology 2023Quote: ... then for 1 hour at room temperature (RT) with biotinylated secondary antibodies and finally with fluorochrome-labeled (BioLegend) or peroxidase-labeled streptavidin (Beckman Coulter) ...
-
bioRxiv - Cancer Biology 2023Quote: ... transgenic T cells were labeled with Tag-it Violet Proliferation and Cell Tracking Dye (Cat No. 425101 Biolegend). The frequency of SMARTA cells that proliferated during culture was determined as described by Gett et al ...
-
bioRxiv - Immunology 2023Quote: ... The cells were washed with cold PBS and PE-labeled anti-human IgG Fc secondary antibody (Biolegend, 41070) was added and incubated for 30 min at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... or MCC:I-Ek (cognate) tethered pMHCII complexes were labeled with Tag-it Violet according to the manufacturer’s instructions (BioLegend). M12 cells and 58α-β- cells were then chilled on ice for 30 minutes ...
-
bioRxiv - Immunology 2024Quote: ... and then stained for 30 minutes on ice with an APC-labeled antibody against CD3 (BioLegend; clone UCHT1), phycoerythrinCy7–labeled (PE-Cy7–labeled ...
-
bioRxiv - Immunology 2024Quote: ... Half of the fresh biopsies from each donor were labeled with TotalSeq-A0251 barcode sequence GTCAACTCTTTAGCG (Biolegend 394601), and the other half of the fresh biopsy sample was labeled with MULTI-seq lipid-tag barcode sequence CCTTGGCACCCGAGAATTCCAGGAGAAGA66 ...
-
bioRxiv - Immunology 2024Quote: ... Half of the cryopreserved biopsies from each donor were labeled with TotalSeq-A0252 barcode sequence TGATGGCCTATTGGG (Biolegend 394603), and the other half of the cryopreserved biopsy sample was labeled with MULTI-seq lipid-tag barcode sequence CCTTGGCACCCGAGAATTCCACCACAATG66 ...
-
bioRxiv - Neuroscience 2020Quote: ... 50-μm brain sections were blocked with normal goat serum for 2 h and incubated overnight using biotin-conjugated anti-HA (Biolegend 901505, 1:500) and anti-parvalbumin (Synaptic Systems 195 004 ...
-
bioRxiv - Neuroscience 2020Quote: ... 50μM coronal sections containing dorsal hippocampus were blocked in normal goat serum for 2 h and incubated overnight using a biotin conjugated anti-HA (Biolegend 901505, 1:500), anti-pS6 244-247 (ThermoFisher 44-923G ...
-
bioRxiv - Immunology 2022Quote: ... Fc receptors were blocked with anti-mouse CD16/CD32 antibodies and stained with fluorophore or biotin-conjugated anti-mouse antibodies (BD Pharmingen, Biolegend, Tonbo or eBioscience) to detect B220 (RA3-6B2) ...
-
bioRxiv - Immunology 2019Quote: ... B220 (PE-Cy5, RA3-6B2, BioLegend, #103210; BV650, RA3-6B2, BioLegend, #103241; PE-Cy7, RA3-6B2, BioLegend, #103222; biotin, RA3-6B2, BD, #553085), CXCR5 (BV421 ...
-
bioRxiv - Immunology 2023Quote: Biotinylated pneumococcal serotype 3 polysaccharide with a 5% biotin load was coupled with high concentration streptavidin-phycoerythrin (SA-PE) and streptavidin-allophycocyanin (SA-APC, both from BioLegend, San Diego, CA) in separate reactions ...
-
bioRxiv - Cell Biology 2022Quote: ... recombinant proteins Serpin E2 (BioLegend, 769002) and Serpin A3 (R&D systems ...
-
bioRxiv - Immunology 2021Quote: ... The depleted cell fraction was then stained for 20 min at 4 °C with a cocktail of fluorophore-labeled antibodies CD45-PerCPCy5.5 (1:50) (Biolegend), Ly51-PE (1:800 ...
-
bioRxiv - Genomics 2019Quote: ... The resuspended cells were incubated for 20 min at 4 °C with the fluorophore-labeled antibodies CD45-PerCPCy5.5 (1:50) (Biolegend), Ly51-PE (1:800 ...
-
bioRxiv - Immunology 2021Quote: ... and stained with fluorochrome-labeled anti-mouse IFN-γ/TNF-α/IL-2/IL-4/IL-5 mAbs (Biolegend). LSRFortessa was used to acquire the flow cytometry data ...
-
bioRxiv - Immunology 2021Quote: The following antibody mixture was made and used to stain the flow through and labeled fractions: B220-BV510 (Biolegend) at 1:20 ...
-
bioRxiv - Cancer Biology 2020Quote: ... we collected the beads and labeled them with 4 µg/ml PE anti-CD63 antibody (BioLegend, clone NVG-2) for 45 minutes at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... cells were incubated with A32-APC (3.3 μg/ml) for 25 minutes and labeled with anti-CD3-AF700 (SK7, Biolegend) and anti-CD32-PE-Cy7 (FUN-2 ...
-
bioRxiv - Bioengineering 2022Quote: ... and then stained with the fluorescently labeled antibody that detects the corresponding cell surface receptor (anti-EGFR-BV421, Biolegend, Cat ...
-
bioRxiv - Immunology 2021Quote: ... counted and up to 1×108 cells were labeled with 1.5-2 μM Carboxyfluorescein succinimidyl ester (CFSE; BioLegend, USA) in 1 mL PBS 1X for 20 min according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell suspensions were washed and incubated with fluorescently-labeled antibodies (B220 V500, FAS FITC, CD38 Alexa fluor 700; Biolegend) for 20-40 min ...
-
bioRxiv - Immunology 2019Quote: ... OVA presentation was confirmed by flow cytometry using a PE-labeled antibody against surface SIINFEKL bound to H-2Kb (clone 25-D1.16, BioLegend).
-
bioRxiv - Immunology 2020Quote: ... OVA presentation was confirmed by flow cytometry using a PE-labeled antibody against surface SIINFEKL bound to H-2Kb (clone 25-D1.16, BioLegend).
-
bioRxiv - Systems Biology 2021Quote: ... and then stained the cells for 30 min with 1:500 anti-NGFR APC-labeled clone ME20.4 (BioLegend, 345107). We washed the cells five times with 0.1% BSA/PBS and followed with one final wash with PBS for 2 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... Stem and progenitor cells were isolated using fluorescently labeled or biotinylated antibodies for the following antigens: cKit (2B8, Biolegend), Sca1 (D7 ...
-
bioRxiv - Immunology 2022Quote: ... MR1 surface expression was evaluated by flow cytometry with APC-labeled mouse anti-MR1 mAbs 26.5 (Biolegend, Cat#361108) and APC-labeled mouse IgG2a (clone MOPC-173 Biolegend ...
-
bioRxiv - Immunology 2022Quote: ... and stained with a cocktail of fluorescently labeled anti-cytokine antibodies: IFN-γ PE/Dazzle 594 (Biolegend, cat.505845), TNF-α PE/Cyanine7 (Biolegend ...
-
bioRxiv - Cancer Biology 2022Quote: ... Single cell suspensions from individual tumors were then labeled with hashtag oligonucleotides following the manufacturer’s protocol (TotalSeq B0301-B0306, Biolegend). Each individual tumor sample was counted and then pooled at an equal cell ratio before being split into two replicates for library preparation with the Chromium Single Cell 3’ V3 (10X Genomics ...
-
bioRxiv - Neuroscience 2023Quote: ... For further experiments viable CD45highCD8+ cells were labeled with rat anti-CD45 APC (1:100, catalog no. 103111; BioLegend), rat anti-CD8 PerCP/Cyanine5.5 (1:100 ...
-
bioRxiv - Immunology 2023Quote: ... cells treated with a Foxp3/Transcription factor staining buffer kit (Cat. TNB-0607, TOMBO Bioscience) were stained with FITC-labeled anti-mouse CD4 Ab (GK1.5, BioLegend) and allophycocyanin-labeled anti-mouse Foxp3 Ab (3G3 ...
-
bioRxiv - Immunology 2023Quote: ... to lyse the red blood cells and then stained on ice for 30 minutes with the following antibodies: BV421-labeled CD45.1 (A20, BioLegend), BV785-labeled CD45.2 (104 ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were labeled with antibodies detecting the following cell-surface markers: CD133-APC (Biolegend, clone 7, dilution 1:20), CD19-PECy7 (Biolegend ...
-
bioRxiv - Immunology 2023Quote: ... Enriched samples were then stained on ice for 30 minutes with the following antibodies: BV421-labeled CD45.1 (A20, BioLegend), BV785-labeled CD45.2 (104 ...
-
bioRxiv - Immunology 2024Quote: ... Then the cells were labeled as described above using antibodies anti-CD3-BV421 (clone 17A2) (BioLegend, SanDiego, CA, USA) (1:200 ...