Labshake search
Citations for Roche :
301 - 350 of 4733 citations for PCR Master Mix since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... using the FastStart SYBR Green Master Mix (Roche). RPL13A and ACTB were used as housekeeping genes and data analysed using the 2ΔΔCT method ...
-
bioRxiv - Physiology 2021Quote: ... FastStart Essential DNA Green Master Mix (2X, Roche), forward and reverse primers and cDNA template (1:5 diluted) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5μL FastStart Essential DNA Green Master mix (Roche), and 0.1μL each of 10μM forward and reverse primers (see table below) ...
-
bioRxiv - Microbiology 2022Quote: ... LightCycler 480 SYBR Green I Master mix (Roche) and normalization using GAPDH as described (Mousseau et al. ...
-
bioRxiv - Immunology 2019Quote: ... with either FastStart Universal Probe Master Mix (Roche) or RT2 SYBR Green qPCR Master Mix (Qiagen) ...
-
bioRxiv - Immunology 2019Quote: ... using the FastStart SYBR Green Master Mix (Roche). Cyclophilin (CPH2 ...
-
bioRxiv - Developmental Biology 2019Quote: ... with Light Cycler 480 Probes Master Mix (Roche) on Light Cycler 480 (Roche) ...
-
bioRxiv - Cancer Biology 2021Quote: ... using FastStart Essential DNA Green Master Mix (Roche). Expression levels were normalized to ATPasecf6.
-
bioRxiv - Immunology 2020Quote: ... with either FastStart Universal Probe Master Mix (Roche) or RT4 SYBR Green qPCR Master Mix (Qiagen) ...
-
bioRxiv - Genetics 2021Quote: ... LightCycler 480 SYBR Green I Master mix (Roche) was used for quantitative real-time PCR (RT-qPCR ...
-
bioRxiv - Cell Biology 2021Quote: ... using Power SYBR® Green Master Mix (Roche) and specific primers (described in supplementary Table S2) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and SYBR Green Master Mix (Roche, Basal, Switzerland). Actb was used as an internal control ...
-
bioRxiv - Cancer Biology 2022Quote: ... by using the SYBR Green master mix (Roche) and the LightCycler 480 instrument (Roche) ...
-
bioRxiv - Genomics 2022Quote: ... 1034.6 μL Kapa Hifi 2X Master Mix (Roche), 82.8 μL cDNA amplification forward primer (10 μM ...
-
bioRxiv - Neuroscience 2023Quote: ... KAPA SYBR FAST qPCR Master Mix (Kapa Biosystems) was used in 6μl triplicate reactions containing 2.5 ng genomic DNA and 200 nM primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... using Universal SYBR Master Mix (KAPA Biosystems, KR0389) on CFX-96/384 thermal cyclers (BIO-RAD) ...
-
bioRxiv - Biophysics 2023Quote: ... SYBR Green mix (Roche, LightCycler 480 I Master). To normalize the cDNA amount among different conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... with SYBR Green I Master Mix reagent (Roche) and the primers listed in Table 1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Fast-Start Universal Probe Master Mix (Roche). Ct values were normalized to TATA box-binding protein (TBP) ...
-
bioRxiv - Cell Biology 2023Quote: ... using FastStart universal SYBR green master mix (Roche).
-
bioRxiv - Cell Biology 2024Quote: ... using SYBR Green I Master Mix (4887352001, Roche). The relative expression of genes was normalized to the expression of Tuba1a ...
-
bioRxiv - Cell Biology 2024Quote: ... using SYBR Green I Master Mix (4887352001, Roche). Specific primers for ChIP-qPCR analysis are listed in Suppl ...
-
bioRxiv - Microbiology 2024Quote: ... Fast SYBR Green Master Mix (Roche, cat# 4913850001) was used ...
-
bioRxiv - Molecular Biology 2024Quote: ... 25μl 2x KAPA HiFi master mix (Roche, #KK2602), 1μl Partial R1 – CTACACGACGCTCTTCCGATCT (10μM) ...
-
bioRxiv - Cell Biology 2024Quote: ... using SYBR Green I Master Mix (4887352001, Roche). Specific primers for ChIP-qPCR analysis are listed in Suppl ...
-
bioRxiv - Microbiology 2023Quote: ... The reaction mix used was FastStart Essential DNA Green Master mix (Roche; 06402712001). Real time PCR assay was performed on Quant studio 5 real time PCR machine (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... The reaction mix used was FastStart Essential DNA Green Master mix (Roche; 06402712001). Real time PCR assay was performed on Quant studio 5 real time PCR machine (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2019Quote: ... The PCR reaction mixture in a 20 μl volume containing 10 μl of 2×SYBR Green PCR Master Mix (Roche, Mannheim, Germany, code#06402712001), 2 μl diluted reverse transcriptase product (1:100) ...
-
bioRxiv - Genetics 2021Quote: ... Real-time quantitative PCR (qPCR) was performed using SYBR Green Master Mix and the LightCycler® 480 instrument (Roche). Relative levels of gene expression were analyzed using the 2ΔΔCt method and compared to the expression of the human housekeeping gene PPIB ...
-
bioRxiv - Genetics 2021Quote: ... Real-time quantitative PCR (qPCR) was performed using SYBR Green Master Mix and the LightCycler® 480 instrument (Roche). Relative levels of gene expression were analyzed using the 2ΔΔCt method and compared to the expression of the human housekeeping gene PPIB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of PCR gene specific primer (10X conc) (Table S1) and 10 μl of master mix (Roche 04707516001) in 20 μl reaction ...
-
bioRxiv - Genomics 2019Quote: ... we performed qRT-PCR with Unique Aptamer™ qPCR SYBR® Green Master Mix (Novogene) on the RocheLightCycler480 (Roche) using the same samples used for next-generation sequencing to validate the alternative TES in different cell types ...
-
bioRxiv - Genomics 2020Quote: ... 5 ul of the three amplicons with 20 μl of PCR master mix containing 1.25X KAPA HiFi HotStart ReadyMix (Roche), 0.375 uM of the i5 primer (Microsynth AG ...
-
bioRxiv - Genomics 2020Quote: ... each PCR reaction was assembled by combining 5 ul of the pooled barcoded cDNA with 20 μl of PCR master mix (1.25X KAPA HiFi HotStart ReadyMix [Roche] ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was amplified using gene specific primers and the LightCycler 480 SYBR Green PCR Master Mix (Roche, Basel, Switzerland) on Lightcycler 480 instrument (Roche) ...
-
bioRxiv - Neuroscience 2022Quote: ... Realtime PCR was performed by using SYBR Green dye detection according to the manufacturer’s instruction (SYBR Green PCR Master Mix, Roche) on a LightCycler480 system ...
-
bioRxiv - Bioengineering 2022Quote: ... and quantitative PCR was performed on a Roche LightCycler 96 using the FastStart Essential DNA Green Master mix (Roche) with the following condition ...
-
bioRxiv - Developmental Biology 2022Quote: ... and PCR products were quantified fluorometrically using the KAPA SYBR FAST qPCR Master Mix (2X) Kit (KR0389, KAPA Biosystems).
-
bioRxiv - Cell Biology 2022Quote: ... cDNA was diluted 1:5 in PCR-grade dH2O and 1.5 µl of the cDNA-mix was used per 20 µl real-time PCR reaction with 0.25 µM of each primer and 2 x FastStart Essential DNA Green Master Mix (Roche). For each target and reference gene ...
-
bioRxiv - Genomics 2020Quote: ... DNA on the beads was PCR amplified with barcoded primers using KAPA SYBR FAST qPCR Master Mix (Kapa Biosystems) for 5~12 PCR cycles to obtain enough DNA for sequencing ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative PCR reactions were performed in a total volume of 10 μL of SYBR Green master mix I (Roche) in 384-wells plates on a Lightcycler LC480 apparatus (Roche ...
-
bioRxiv - Physiology 2019Quote: ... The qRT-PCR reactions were carried out in triplicate in 96-well plates and each PCR sample consisted of 6μl 2X SYBR green master mix buffer (Roche), 0.024μl of forward and reverse primers 25nmole and 3.953μl of RNase-free water ...
-
bioRxiv - Cancer Biology 2022Quote: ... mRNA expression levels were determined by qRT-PCR with KAPA SYBR FAST qPCR Master Mix Kit (Kapa Biosystems, KK4610). cDNA was synthesized from human cells using SuperPrep II Cell Lysis & RT Kit (TOYOBO ...
-
bioRxiv - Microbiology 2022Quote: Quantitative Real-time PCR assays were performed with the KAPA SYBR FAST qPCR Master Mix (2X) Kit (Kapa Biosystems) on a LightCycler 1.5 (Roche ...
-
bioRxiv - Plant Biology 2022Quote: ... qRT-PCR reactions were performed using the KAPA SYBR FAST qPCR Master Mix (2X) Kit (KAPA Biosystems, Wilmington, USA) on the QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2023Quote: ... Real time PCR was performed on the cDNA using KAPA SYBR FAST qPCR Master Mix (2X) kit (Roche, #KK4618) with intron spanning primers in a QuantStudio 3 Real-time PCR system ...
-
bioRxiv - Cell Biology 2023Quote: ... The resulting cDNA was analysed by qRT-PCR on a LightCycler 480 using SYBR Green 1 Master Mix (Roche). Relative fold change in expression was determined by the ddCt method ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative real-time PCR was performed in 384-well plates with FastStart Universal SYBR Green Master Mix (04913914001, Roche) on QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2023Quote: ... RT-PCR analysis was performed using the FastStart Essential DNA Green Master mix and LightCycler 96 (Roche Applied Science). Relative transcript levels were determined by normalizing with PP2A (At1g13320 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The PCR kit used was FastStrat PCR Master (Roche, 04710436001). The amplification product from mutated allele has a 341bp size and the one obtained from a wild-type allele is 262bp ...