Labshake search
Citations for Roche :
501 - 550 of 4733 citations for PCR Master Mix since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... RT-qPCR was performed using FastStart Universal Probe Master Mix (Roche) and expression was calculated against two reference genes (SlActin-like and SlUbiquitin ...
-
bioRxiv - Cancer Biology 2020Quote: ... qPCR reactions were assembled with FastStart SYBR Green Master Mix (Roche) and run on a QuantStudio6 thermal cycler (Thermo) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... using FastStart Universal SYBR Green Master mix (carboxy-X-rhodamine; Roche) and HCoV-NL63 N gene-specific primers (Forward ...
-
bioRxiv - Cancer Biology 2020Quote: ... Quantitative gene expression was performed using SYBR Green master mix (Roche) on LightCycler 480 Instrument (Roche) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... qPCR analysis have been performed using SYBR Green Master Mix (Roche) and the following primers ...
-
bioRxiv - Cancer Biology 2021Quote: ... Gene levels determined using Faststart essential Syber Green master mix (Roche) on a Roche Lightcycler Nano ...
-
bioRxiv - Microbiology 2021Quote: ... Amplification reaction was performed with LightCycler 480 Probes Master mix (Roche), 10ng of individual genomic DNA ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 μl FastStart Universal SYBR Green Master mix (Roche, Basel, Switzerland) and 3 μl MilliQ ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the KapaSYBR® FAST SYBR Green Master Mix (Kapa Biosystems). Each reaction was performed in triplicates and values were normalized to murine 36B4 housekeeping gene ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative gene expression was performed using SYBR Green master mix (Roche) on LightCycler 480 Instrument (Roche) ...
-
bioRxiv - Cell Biology 2022Quote: ... or Kapa SYBR Fast qPCR Master Mix (Kapa Biosystems, Cat#KK4602). Data of each mRNA were normalized to that of RPS18 or GAPDH ...
-
bioRxiv - Plant Biology 2022Quote: ... was used with SYBR green I qPCR master mix (Roche Diagnostics). For the validation of gene expression identified in the single-cell RNA sequencing analysis ...
-
bioRxiv - Molecular Biology 2022Quote: ... with the LightCycler 480 SYBR Green 1 qPCR master mix (Roche) using the following program ...
-
bioRxiv - Immunology 2023Quote: ... was mixed with a DNA SYBR Green I Master Mix (Roche) on a LightCycler machine (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... using Kapa SYBR Fast qPCR Master Mix (Kapa Biosystems, Cat#KK4602). Data were normalized to GAPDH ...
-
bioRxiv - Molecular Biology 2023Quote: ... using FastStart Universal SYBR Green Master Mix (Rox) (Roche Life Science). Relative expression was determined by the 2-ΔΔCt method (130 ...
-
bioRxiv - Physiology 2023Quote: ... and subjected to qPCR with SybrGreen Master Mix (Roche; Cat. #4707516001) using rat primers (Table 1) ...
-
bioRxiv - Genetics 2023Quote: ... and KAPA Universal qPCR Master Mix (KAPA Biosystems, KK4824/Roche 07960140001). The products were pooled as equimolar and subjected to deep sequencing using MiniSeq (Illumina) ...
-
bioRxiv - Genetics 2023Quote: ... and KAPA Universal qPCR Master Mix (KAPA Biosystems, KK4824/Roche 07960140001). The libraries were deep- sequenced as a pool using paired-end 150-bp run on an Illumina MiniSeq with the following parameters ...
-
bioRxiv - Genetics 2023Quote: ... and KAPA Universal qPCR Master Mix (KAPA Biosystems, KK4824/Roche 07960140001). The products were pooled as equimolar and subjected to deep sequencing using MiniSeq (Illumina) ...
-
bioRxiv - Genetics 2023Quote: ... and KAPA Universal qPCR Master Mix (KAPA Biosystems, KK4824/Roche 07960140001). The products were pooled as equimolar and subjected to deep sequencing using MiniSeq (Illumina) ...
-
bioRxiv - Genetics 2023Quote: ... and KAPA Universal qPCR Master Mix (KAPA Biosystems, KK4824/Roche 07960140001). The products were pooled as equimolar and subjected to deep sequencing using MiniSeq (Illumina) ...
-
bioRxiv - Cancer Biology 2023Quote: ... for which Lightcycler 480 SYBR Green I Master mix (Roche diagnostics) was used ...
-
bioRxiv - Microbiology 2023Quote: ... also applying the KAPA SYBR FAST qPCR Master Mix (KAPA Biosystems) on the LightCycler® 96 (Roche) ...
-
bioRxiv - Genetics 2023Quote: ... and KAPA Universal qPCR Master Mix (KAPA Biosystems, KK4824/Roche 07960140001). The libraries were deep- sequenced as a pool using paired-end 150-bp run on an Illumina MiniSeq with the following parameters ...
-
bioRxiv - Synthetic Biology 2023Quote: ... qPCR amplification was performed using the KAPA HiFi master mix (Roche) with forward primers AATGATACGGCGACCACCGAGATCTACAC[8nt-long index barcode]AGCGTGACAGGGACATCGTAGAGAGTCGTACTTA and reverse primers CAAGCAGAAGACGGCATACGAGAT[8nt-long index barcode]AAGCAGTGGTATCAACGCAGA ...
-
bioRxiv - Genetics 2023Quote: ... Gene expression was determined using KAPA SYBR FAST Master Mix (Roche) and gene-specific primers (Table S1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... RT-qPCR was performed with FastStart SYBR Green Master mix (Roche) with optimized primer pairs ...
-
bioRxiv - Cancer Biology 2023Quote: ... The enriched libraries were amplified with KAPA HiFi master mix (Roche) prior to sequencing ...
-
bioRxiv - Genetics 2023Quote: ... using the FastStart Universal SYBR Green Master Mix (Roche, Indianapolis, Indiana). The following PCR cycle was used for all RT-qPCR experiments ...
-
bioRxiv - Genomics 2023Quote: ... and the LightCycler 480 SYBR Green I Master mix (Roche 04887352001). The mean relative expression of technical replicates of each sample was measure by the CFX Manager software (Bio-Rad ...
-
bioRxiv - Plant Biology 2023Quote: ... 200 nM primers and KAPA SYBR FAST master mix (KAPA Biosystems). RT-qPCR reactions and were performed on a 7500 Fast Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... using KAPA Sybr Fast Universal qPCR master mix (Kapa biosystems (#KK4602). Mean strain DNA quantities were calculated using a standard curve to determine relative abundance of S ...
-
bioRxiv - Molecular Biology 2024Quote: ... the purified DNA was mixed with SYBR Green master mix (Roche) and specific primers ...
-
bioRxiv - Biochemistry 2024Quote: ... and KAPA Universal qPCR Master Mix (KAPA Biosystems, KK4824/Roche 07960140001). The products were pooled as equimolar and subjected to deep sequencing using NovaSeq (Illumina).
-
bioRxiv - Biochemistry 2024Quote: ... and KAPA Universal qPCR Master Mix (KAPA Biosystems, KK4824/Roche 07960140001). The products were pooled as equimolar and subjected to deep sequencing using MiniSeq (Illumina).
-
bioRxiv - Biochemistry 2024Quote: ... and KAPA Universal qPCR Master Mix (KAPA Biosystems, KK4824/Roche 07960140001). The products were pooled as equimolar and subjected to deep sequencing using MiniSeq (Illumina).
-
bioRxiv - Biochemistry 2024Quote: ... and KAPA Universal qPCR Master Mix (KAPA Biosystems, KK4824/Roche 07960140001). The products were pooled as equimolar and subjected to deep sequencing using NovaSeq (Illumina).
-
bioRxiv - Cancer Biology 2024Quote: qPCR reactions containing 1X KAPA SYBR Fast qPCR Master Mix (Roche), transcript-specific primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... The qRT-PCR analysis was conducted using a LightCycler 480 Real-Time PCR System and LightCycler 480 SYBR Green I Master mix (Roche Applied Science, Germany). 18S RNA (adult tissue and embryonic-early larval samples ...
-
bioRxiv - Developmental Biology 2020Quote: ... was used to recover and then amplify the converted DNA fragments through PCR with a maximum of 12 cycles with Kapa HiFi U+ Master Mix (Kapa Biosystems, cat.: KK2801). Barcodes were introduced during this process.
-
bioRxiv - Microbiology 2019Quote: ... a quantitative real-time PCR was carried out in duplicate with a LC 480 SYBR Green QPCR Master Mix (Roche Diagnostics, Mannheim, Germany) in a light Cycler 2.0 system instrument ...
-
bioRxiv - Paleontology 2022Quote: ... The final libraries were quantified on an Applied Biosystems™ QuantStudio™ 7 Flex Real-Time PCR System using the KAPA SYBR® FAST ROX Low qPCR Master Mix for Illumina platforms (KAPA Biosystems, KK4873). DNA extracted from mammoth and sloth boluses were sequenced on an Illumina MiSeq using the 600-cycle v3 kit (Illumina ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The qRT-PCR was performed with the Hieff® qPCR SYBR® Green Master Mix (Yeasen, China) and a LightCycler 480 II Instrument (Roche, Switzerland). Six biological replicates and three reaction replicates for each group were used ...
-
bioRxiv - Genomics 2019Quote: ... and 5 refers to the CRE Number and Affinity library) and with KAPA HiFi HotStart Real-time PCR Master Mix (2X) (Kapa Biosystems, Wilmington, MA) following the recommended cycling protocol at 14 cycles ...
-
bioRxiv - Microbiology 2020Quote: ... 8.4 μL of PCR Probe water and 10 μL of the 2x commercial reaction mixture (SYBR® Green Master Mix, Bio-Rad. A LightCycler96® (Roche) device was used and PCR conditions applied were ...
-
bioRxiv - Neuroscience 2022Quote: ... Real-time RT-PCR was then performed using the KAPA SYBR FAST qPCR Master Mix (2x) Kit (Kapa Biosystems, Cape Town, South Africa) in LightCycler 480® (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... 0.09 ng of cDNA per well was used in qRT-PCR with KAPA SYBR® FAST qPCR Master Mix Kit (2×) (KAPA Biosystems, USA) on an Applied StepOnePlusTM Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR was performed using Hieff qPCR SYBR® Green Master Mix (Yeasen, China) in LightCycler® 96 real-time PCR instrument (Roche, China), followed the instructions.
-
bioRxiv - Cell Biology 2023Quote: ... Reverse transcription and real-time qPCR reaction were carried out with KAPA SYBR FAST One-Step qRT-PCR Master Mix Kit (KAPA Biosystems, Wilmington, MA) on LighyCycler 480 system (Roche ...