Labshake search
Citations for Roche :
51 - 100 of 3452 citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... was employed using Kapa Sybr Fast qPCR Master Mix (2x) Kit (Kapa Biosystems, Wilmington, MA, USA). RNA expression of target genes relative to GAPDH was quantified by 2ΔΔCT-method ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Real-time qPCR was performed using the KAPA SYBR FAST qPCR 2X master mix (Kapa Biosystems) on a Mastercycler ep Realplex (Eppendorf ...
-
bioRxiv - Genomics 2019Quote: ... The qPCR was performed with KAPA HiFi HotStart Real-time PCR Master Mix (2X) (Kapa Biosystems) for 11 cycles following the recommended cycling protocol ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The qRT-PCR was performed using KAPA SYBR FAST qPCR Master Mix (2X) Kit (KAPA Biosystems) with StepOnePlus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Genomics 2023Quote: ... Converted cDNA is quantified using 2x KAPA SYBR Fast Master Mix ROX Low (KAPA Biosystems, KK4620), with primers against upstream RHOXF2B TSS ...
-
bioRxiv - Systems Biology 2023Quote: ... 60 µL whole-transcriptome amplification (WTA) master mix (50 µL 2x KAPA HiFi Hotstart Readymix [Roche #KK2602] ...
-
bioRxiv - Cell Biology 2020Quote: ... and analyzed by qPCR using the KAPA SYBR Green 2x PCR master mix (Kapa Biosystems, Wilmington, MA) in an Eppendorf Realplex 2 Mastercycler according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and internal sites removed via PCR using KAPA HiFi HotStart DNA Polymerase with 2X Master Mix (Roche), or synthesized (Integrated DNA Technologies) ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR mix consisted of 5 μL 2X LightCycler® 480 Probes Master (Roche, Cat. No. 04707494001), 1 μL MDA product ...
-
bioRxiv - Genomics 2019Quote: ... 0.5 ng of plasmid was amplified using primers with P5 and P7 Illumina flow cell adapter sequences (Libseq_P7_For and Libseq_P5_Rev) and KAPA HiFi HotStart Real-time PCR Master Mix (2X) (Kapa Biosystems) for 17 cycles ...
-
bioRxiv - Systems Biology 2020Quote: ... Quantitative PCR was done using KAPA SYBR® FAST Universal 2X qPCR Master Mix (KAPA Biosystems KK4601) and LightCycler 96 instrument (Roche) ...
-
bioRxiv - Neuroscience 2022Quote: ... and used as template for PCR using KAPA HiFi HotStart DNA Polymerase with 2X Master Mix (Roche) to amplify the target sequence in exon 4 of Nlgn3 using forward 5’ CCCCAGAAGCTAGCCATGGTCAC 3’ and reverse 5’ GACAGGACCTATAAAACTCAGCCAAG 3’ primers ...
-
bioRxiv - Microbiology 2023Quote: ... Each PCR reaction consisted of 12.5 μl KAPA 2x HiFi Master Mix (KAPA Biosystems, Wilmington, MA, USA), 0.5 μl of 10 μM forward primer ...
-
bioRxiv - Immunology 2023Quote: ... qPCR reactions were performed using the KAPA SYBR® FAST qPCR Master Mix (2X) Kit (Kapa Biosystems) on an Agilent Stratagene Mx3000P Multiplex Quantitative PCR System under the following conditions ...
-
bioRxiv - Genomics 2023Quote: ... The cDNA was amplified by combining 25 μL of the silane purified product with PCR master mix (25 μL 2X Kapa HotStart Mix (Kapa Biosystems #KK2602), 2 μL of 5 μM SMART PCR primer ...
-
bioRxiv - Microbiology 2023Quote: ... 2X cOmplete Protease Inhibitor mix (Roche)) and sonicated on ice for a total of 10 min at 30% intensity ...
-
bioRxiv - Physiology 2019Quote: ... PCR was carried out with KAPA SYBR® FAST Universal 2X qPCR Master Mix (Cat# KK4601) / LightCycler 480 SYBR Green I Master kit (Roche Cat# 14712220) in Vapo.Protect Eppendorf LC-480 and LC-96 from Roche system using primer pairs mentioned in Supplementary Table A.
-
bioRxiv - Molecular Biology 2019Quote: ... reactions were performed in 384-well plates with each well containing 7.5 µl 2x probe master mix (Roche), 1.25 µl H2) ...
-
bioRxiv - Microbiology 2021Quote: ... the gDNA fragments were amplified using 5 rounds of PCR with KAPA HiFi 2X master mix (KAPA Biosystems). See Table S4 for primer sequences ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative PCR was conducted using the KAPA SYBR FAST qPCR Master Mix (2X) Kit (KAPA Biosystems, MA, USA) and LightCycler 96 (Roche Diagnostics ...
-
bioRxiv - Developmental Biology 2019Quote: ... Quantitative PCR mixtures were prepared using the KAPA SYBR® FAST qPCR Master Mix (2X) Kit (Kapa Biosystems), 4.2µl of cDNA and 200nM of each of the forward and reverse primers ...
-
bioRxiv - Genomics 2020Quote: Ligated and purified libraries were amplified using KAPA HiFi HotStart Real-time PCR 2X Master Mix (KAPA Biosystems). AT libraries were amplified with 2 μL of KAPA P5 primer and 2 μL of SureSelect P7 Index primer ...
-
bioRxiv - Neuroscience 2021Quote: ... ATAC-seq library amplification was done using the KAPA SYBR FAST qPCR Master Mix (2X) Kit (Kapa Biosystems) and 1.25 μM indexed primers using the following PCR conditions ...
-
bioRxiv - Genomics 2021Quote: ... Ligated and purified libraries were amplified using KAPA HiFi HotStart Real-time PCR 2X Master Mix (KAPA Biosystems). Samples were amplified with 5 μL of KAPA P5 and KAPA P7 primers ...
-
bioRxiv - Plant Biology 2022Quote: ... Real-time PCR was carried out using a KAPA SYBR FAST qPCR Master Mix 2X (Kapa Biosystems, USA), a qTOWER3 G touch (Analytik Jena AG ...
-
bioRxiv - Cell Biology 2020Quote: ... or the TaqMan® Universal Master Mix II when using the Universal Probe Library (Roche). The primer sequences and probes are listed in Table 3 ...
-
bioRxiv - Genomics 2020Quote: ... The qPCR was performed using 1X Kapa probe fast qPCR 2X master mix (KAPA Biosystems Inc, catalog no. KK4702), 140 nM TaqMan probe (IDT) ...
-
bioRxiv - Plant Biology 2021Quote: ... 500 nM of each primers and 5 μl of 2X LightCycler® 480 SYBR Green I Master mix (Roche) in 10 μl final volume ...
-
bioRxiv - Molecular Biology 2020Quote: ... The qPCR was performed using KAPA SYBR® FAST qPCR Kit Master Mix (2X) Universal (Kapa Biosystems; Massachusetts, USA). Protein expression at day 10 post transfection was analyzed by immunocytochemistry using the following antibodies and dilutions ...
-
bioRxiv - Developmental Biology 2022Quote: ... and PCR products were quantified fluorometrically using the KAPA SYBR FAST qPCR Master Mix (2X) Kit (KR0389, KAPA Biosystems).
-
bioRxiv - Physiology 2019Quote: ... The qRT-PCR reactions were carried out in triplicate in 96-well plates and each PCR sample consisted of 6μl 2X SYBR green master mix buffer (Roche), 0.024μl of forward and reverse primers 25nmole and 3.953μl of RNase-free water ...
-
bioRxiv - Genomics 2020Quote: ... PCR reactions contain 20 ng input DNA in 12.5μl of KAPA 2X Master Mix (KAPA HiFi HotStart ReadyMix. Catalog number: KK2602. Vendor: Roche Diagnostic), 10μM forward primer and/or 10μM reverse primer ...
-
bioRxiv - Microbiology 2022Quote: Quantitative Real-time PCR assays were performed with the KAPA SYBR FAST qPCR Master Mix (2X) Kit (Kapa Biosystems) on a LightCycler 1.5 (Roche ...
-
bioRxiv - Plant Biology 2022Quote: ... qRT-PCR reactions were performed using the KAPA SYBR FAST qPCR Master Mix (2X) Kit (KAPA Biosystems, Wilmington, USA) on the QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2023Quote: ... Real time PCR was performed on the cDNA using KAPA SYBR FAST qPCR Master Mix (2X) kit (Roche, #KK4618) with intron spanning primers in a QuantStudio 3 Real-time PCR system ...
-
bioRxiv - Microbiology 2023Quote: ... Each 5 μl reaction contained 2.5 μl of LightCycler 480 SYBR Green I Master mix 2X (Roche Applied Science), 0.5 μl of each primer (300 nM final ...
-
bioRxiv - Biochemistry 2024Quote: ... 9 μl of qPCR reaction was set up in 384 well plates with 4.5 μl of 2X FastStart Universal SYBR Green Master mix ROX (Roche), ∼0.28 μM of primers (Set 1 ...
-
bioRxiv - Microbiology 2024Quote: ... the master mix was added and the plate was placed in a LightCycler 480 II (Roche). The results were evaluated by Delta delta CT method considering the Cp values obtained from LightCycler 480 Software release 1.5.0 ...
-
bioRxiv - Molecular Biology 2020Quote: ... We then used four times fewer cycles than indicated by the qPCR to lead to logarithmic phase of amplification and prepared a PCR reaction of 50 µl PCR master mix consisting of 25µl of 2x KAPA HiFi Uracil+ hot start polymerase (Roche # KK2800) mix ...
-
bioRxiv - Molecular Biology 2021Quote: ... the cDNA samples were amplified using LightCycler® 480 SYBR® Green 2x PCR Master Mix I (Roche, Cat# 04887352001) and 0.3 or 0.6 μM of forward and reverse primer respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... The vectors containing pegRNA and PE3/PE3b guides were used as template for PCR using KAPA HiFi HotStart DNA Polymerase with 2x Master Mix (Roche) to amplify parts containing the U6 promoter and either the pegRNA or PE3/PE3b guide using primers with BsaI recognition sites ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We did PCRs in a reaction volume of 25 μl containing 12.5 μl 2x FastStart PCR master mix (Roche, Germany), one forward and two reverse MHC IIB primers (Bracamonte et al. ...
-
bioRxiv - Microbiology 2024Quote: ... Primer pair mix with 7 µL of 2X SYBR green (LightCycler 480 SYBR Green I Master; Roche; Cat No. 04707516001) and 1 µL of 10 µM of forward and reverse primer were prepared for all the gene targets ...
-
bioRxiv - Cell Biology 2024Quote: ... The quantitative real-time PCR was done using Maxima SYBR Green/ROX qPCR Master Mix (2X) (Fermentas) and LightCycler 480 (Roche) quantitative PCR machine ...
-
bioRxiv - Cell Biology 2024Quote: ... The quantitative real-time PCR was done using Maxima SYBR Green/ROX qPCR Master Mix (2X) (Fermentas) and LightCycler 480 (Roche) quantitative PCR machine ...
-
bioRxiv - Systems Biology 2019Quote: ... 2x KAPA HiFi Hotstart Ready-mix (KAPA Biosystems), cycle conditions ...
-
bioRxiv - Genetics 2020Quote: ... using 5 µL 2x KAPA mix (Roche, #KK2602), 10 µL cDNA ...
-
bioRxiv - Neuroscience 2021Quote: ... 25µl 2x HIFI HotStart Ready Mix (Kapa Biosystems), and 0.2M SMART PCR Primer ...
-
Autocrine Sfrp1 inhibits lung fibroblast invasion during transition to injury induced myofibroblastsbioRxiv - Cell Biology 2022Quote: ... 2x KAPA HiFi Hotstart Ready-mix (KAPA Biosystems), cycle conditions ...
-
bioRxiv - Systems Biology 2023Quote: ... 2x KAPA HiFi HotStart ready-mix (KAPA Biosystems) and NextFlex PCR primers were used for 4 cycles of PCR amplification (98 °C for 2 min ...