Labshake search
Citations for Roche :
1 - 50 of 3452 citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... and 2x Kapa HiFi Master Mix (Roche) in a 50 μl PCR reaction performed in a Thermocycler (Eppendorf mastercycler) ...
-
bioRxiv - Physiology 2021Quote: ... FastStart Essential DNA Green Master Mix (2X, Roche), forward and reverse primers and cDNA template (1:5 diluted) ...
-
bioRxiv - Genomics 2022Quote: ... 1034.6 μL Kapa Hifi 2X Master Mix (Roche), 82.8 μL cDNA amplification forward primer (10 μM ...
-
bioRxiv - Molecular Biology 2024Quote: ... 25μl 2x KAPA HiFi master mix (Roche, #KK2602), 1μl Partial R1 – CTACACGACGCTCTTCCGATCT (10μM) ...
-
bioRxiv - Genetics 2020Quote: ... containing 6.25 μl 2X EagleTaq Universal Master Mix (Roche), 1μl of sample cDNA and 0.63μl of Probe+Primers mix (TaqMan Gene Expression Assays ...
-
bioRxiv - Neuroscience 2023Quote: ... using 2x SYBR GREEN Master Mix (Roche Diagnostic, Switzerland) as reagent ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μl of KAPA HiFi 2X master mix (Roche) and 3 μl of diluted overnight culture grown in 96-well plates ...
-
bioRxiv - Developmental Biology 2021Quote: ... with SYBR Green Master Mix II (Roche), β-Actin was used as reference genes ...
-
bioRxiv - Developmental Biology 2022Quote: ... with SYBR Green Master Mix II (Roche). A melting curve was performed and analyzed for each gene to ensure the specificity of the amplification ...
-
bioRxiv - Cell Biology 2024Quote: ... with SYBR Green Master Mix II (Roche). A melting curve was performed and analyzed for each gene to ensure the specificity of the amplification ...
-
bioRxiv - Systems Biology 2020Quote: ... 2x master mix or Fast Start Universal SYBR Green (Roche) 2x master mix in a 7900HT fast Real-Time PCR system (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2022Quote: ... using the 2X KAPA PCR master mix (Roche cat. #KK2611), and the same program described for the PCR after tagmentation.PCR cleanup and size selection was performed with AmPure XP beads ...
-
bioRxiv - Genomics 2022Quote: ... PCR master mix was purchased from the New England Biolabs (Quick-Load® Taq 2X Master Mix) or from KAPA Biosystems (KAPA HiFi HotStart ReadyMix, 2X). DNA purification kit was purchased from Beckman Coulter (Agencourt AMPure XP kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... with KAPA SYBR FAST Universal 2X qPCR Master Mix (Kapa Biosystems) with optimized concentrations of specific primers ...
-
bioRxiv - Microbiology 2019Quote: ... containing 10ul of Kapa Probe Fast Master Mix 2X (Kapa Biosystems), 250mM of each primer ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was done using SYBR Green 2x master mix (KAPA Biosystems) on a Roche LightCycler 480 system ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was done using SYBR Green 2x master mix (KAPA Biosystems) on a Roche LightCycler 480 system ...
-
bioRxiv - Neuroscience 2023Quote: ... using the Kapa SYBR Fast qPCR Master Mix (2X) kit (Kapa Biosystems) under the following thermal cycling conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... and KAPA SYBR FAST qPCR Master Mix (2X) kit (KAPA BIOSYSTEMS, KK4602) with first strand cDNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... The KAPA SYBR® FAST qPCR Master Mix (2X) Kit (Roche, KK4600) was used ...
-
bioRxiv - Genetics 2024Quote: ... KAPA SYBR® FAST qPCR Master Mix (2X) Universal (Kapa Biosystems, KK4602) was used for qPCR reactions with 18 ng of cDNA as template input ...
-
bioRxiv - Genomics 2024Quote: ... The PCR was done using 2x Kapa HiFi Master mix (Roche, 09420398001) with the barcoded primers described in the Omni-ATAC protocol ...
-
bioRxiv - Microbiology 2023Quote: ... with the LightCycler® 480 SYBR Green I Master Mix (2X, Roche) and the primer pairs RppkF/RppkR for Lc ...
-
bioRxiv - Cell Biology 2019Quote: ... Quantitative PCR was preformed using 2X SYBR Fast Master Mix Universal (Kapa Biosystems) and primers for the indicated genes (see Table S3 for primer sequences ...
-
bioRxiv - Plant Biology 2021Quote: ... and KAPA SYBR® FAST qPCR Master Mix (2X) kit (KAPA BIOSYSTEMS,US). For relative analysis quantitative PCR was performed using cDNA templates ...
-
bioRxiv - Genomics 2020Quote: ... 10 uM primers and the KAPA HiFi 2x PCR Master Mix (KAPA Biosystems) with the following conditions ...
-
bioRxiv - Genomics 2022Quote: ... Amplification reactions contained 1 μL of 2X SYBR Green I Master mix (Roche), 200 nM of each primer ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 µl of 2X LightCycler 480 SYBR Green I Master mix (Roche, USA) was used along with 1 µl of 5 µM of each primer and 2.5 µl cDNA template in a final reaction volume of 20 µl ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCRs were performed using LightCycler® 480 SYBR Green I Master Mix (2X) (Roche) with one reaction containing ...
-
bioRxiv - Immunology 2021Quote: ... and PCR amplified using Nextera primers with 2x HiFi Polymerase Master Mix (KAPA Biosystems). Amplified ...
-
bioRxiv - Plant Biology 2022Quote: ... with KAPA SYBR FAST qPCR Master Mix (2x) Kit (Kapa Biosystems, Wilmington, MA, USA). Relative quantities were determined by using a comparative Ct method as follows ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Triplicate qPCR reactions (10 μl) each contained SYBR Green 1 2X master mix (Roche), 2 µl of a 1:10 cDNA dilution ...
-
bioRxiv - Molecular Biology 2021Quote: ... consisting of 10 µL 2X KAPA SYBR FAST qPCR Master Mix (KAPA Biosystems, USA), 0.2 µM of forward primer ...
-
bioRxiv - Plant Biology 2022Quote: ... For the qPCR reaction mixture KAPA SYBR FAST Master Mix (2x) Universal (Kapa Biosystems) was used with a final concentration of 10 ng template cDNA ...
-
Transcriptional analysis in multiple barley varieties identifies signatures of waterlogging responsebioRxiv - Plant Biology 2023Quote: ... Each PCR reaction mix contained 5 μL of 2x SYBR green master 1 (Roche), 1 μL cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... using 5 µL KAPA SYBR FAST 2x qPCR Master Mix (KAPA Biosystems, Wilmington, MA), 0.3 mM of each primer and 1 µL of DNA template (20 ng µL-1) ...
-
bioRxiv - Plant Biology 2024Quote: ... qPCR was performed using SYBRGreen Master Mix II on a LightCycler 480 II (both Roche) with primer pairs listed in Supplemental Table S1.
-
bioRxiv - Synthetic Biology 2022Quote: ... PCR fragments were amplified using KAPA HiFi HotStart DNA Polymerase with 2X Master Mix (Roche), gel extracted with Zymoclean Gel DNA Recovery kit (Zymo Research) ...
-
bioRxiv - Immunology 2019Quote: ... and then PCR amplified using Nextera primers with 2x HiFi Polymerase Master Mix (KAPA Biosystems). Amplified ...
-
bioRxiv - Genomics 2020Quote: ... SYBR Green assay was performed on Light Cycler 480 instrument (2x Probe Master Mix, Roche). All primer sequences are listed in Table S11 ...
-
bioRxiv - Biochemistry 2022Quote: ... and qRT-PCR was performed using KAPA SYBR FAST Master Mix (2X) Universal (Kapa Biosystems) and the Thermal Cycler Dice Real Time System (Takara) ...
-
bioRxiv - Physiology 2022Quote: ... 5 μL KAPA SYBR® FAST Master Mix (2X) Universal (Kapa Biosystems Inc., MA, USA), and 100 nM of gene-specific primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the KAPA SYBR® Fast qPCR kit master mix (2X) Universal (#KK4601, Roche Diagnostics). Using TS Primer Mix A from the Kit and KAPA SYBR FAST qPCR Master Mix ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the KAPA SYBR® FAST Universal qPCR Master Mix (2x; Kapa Biosystems, Inc., USA). Relative mRNA levels were normalized to 18S expression levels via the ΔΔ method as previously reported (Pérez-Estrada et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the KAPA SYBR® Fast qPCR kit master mix (2X) Universal (#KK4601, Roche Diagnostics). Reaction was set up as per the user guide (#CG000239).
-
bioRxiv - Physiology 2024Quote: ... The reaction volume of 10 μl contained FastStart Essential DNA Green Master Mix (2X, Roche), forward and reverse primers and cDNA template (1:5 diluted) ...
-
bioRxiv - Microbiology 2023Quote: ... the specified primer concentrations and 2X SYBR Green I Master Mix solution (LightCycler® 480 SYBR Green I Master, Roche). Standard curves were generated from known concentrations of 10-fold serial diluted DNA from B ...
-
bioRxiv - Molecular Biology 2020Quote: ... In a 50 μl-reaction the concentrated DNA (15 μl) was mixed with 10 μl of the Nextera index mix (i5 + i7) and 2x Kapa HiFi Master Mix (Roche). The PCR was performed in a Thermocycler (Eppendorf mastercycler ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA libraries were amplified in 50 µL final volume with 2X KAPA HiFi Master Mix (Roche) supplemented with 5 % final concentration DMSO (Sigma ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... RT-qPCR was performed using 2X SYBR Green I master mix (Kapa Biosystems, Cat. No. KK3605) and the reaction was carried out in Roche LightCycler 480 (USA ...