Labshake search
Citations for Roche :
401 - 450 of 3452 citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... using FastStart Universal SYBR Green Master Mix (Rox) (Roche Life Science). Relative expression was determined by the 2-ΔΔCt method (130 ...
-
bioRxiv - Physiology 2023Quote: ... and subjected to qPCR with SybrGreen Master Mix (Roche; Cat. #4707516001) using rat primers (Table 1) ...
-
bioRxiv - Genetics 2023Quote: ... and KAPA Universal qPCR Master Mix (KAPA Biosystems, KK4824/Roche 07960140001). The products were pooled as equimolar and subjected to deep sequencing using MiniSeq (Illumina) ...
-
bioRxiv - Genetics 2023Quote: ... and KAPA Universal qPCR Master Mix (KAPA Biosystems, KK4824/Roche 07960140001). The libraries were deep- sequenced as a pool using paired-end 150-bp run on an Illumina MiniSeq with the following parameters ...
-
bioRxiv - Genetics 2023Quote: ... and KAPA Universal qPCR Master Mix (KAPA Biosystems, KK4824/Roche 07960140001). The products were pooled as equimolar and subjected to deep sequencing using MiniSeq (Illumina) ...
-
bioRxiv - Genetics 2023Quote: ... and KAPA Universal qPCR Master Mix (KAPA Biosystems, KK4824/Roche 07960140001). The products were pooled as equimolar and subjected to deep sequencing using MiniSeq (Illumina) ...
-
bioRxiv - Genetics 2023Quote: ... and KAPA Universal qPCR Master Mix (KAPA Biosystems, KK4824/Roche 07960140001). The products were pooled as equimolar and subjected to deep sequencing using MiniSeq (Illumina) ...
-
bioRxiv - Cancer Biology 2023Quote: ... for which Lightcycler 480 SYBR Green I Master mix (Roche diagnostics) was used ...
-
bioRxiv - Microbiology 2023Quote: ... also applying the KAPA SYBR FAST qPCR Master Mix (KAPA Biosystems) on the LightCycler® 96 (Roche) ...
-
bioRxiv - Genetics 2023Quote: ... and KAPA Universal qPCR Master Mix (KAPA Biosystems, KK4824/Roche 07960140001). The libraries were deep- sequenced as a pool using paired-end 150-bp run on an Illumina MiniSeq with the following parameters ...
-
bioRxiv - Synthetic Biology 2023Quote: ... qPCR amplification was performed using the KAPA HiFi master mix (Roche) with forward primers AATGATACGGCGACCACCGAGATCTACAC[8nt-long index barcode]AGCGTGACAGGGACATCGTAGAGAGTCGTACTTA and reverse primers CAAGCAGAAGACGGCATACGAGAT[8nt-long index barcode]AAGCAGTGGTATCAACGCAGA ...
-
bioRxiv - Genetics 2023Quote: ... Gene expression was determined using KAPA SYBR FAST Master Mix (Roche) and gene-specific primers (Table S1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... RT-qPCR was performed with FastStart SYBR Green Master mix (Roche) with optimized primer pairs ...
-
bioRxiv - Cancer Biology 2023Quote: ... The enriched libraries were amplified with KAPA HiFi master mix (Roche) prior to sequencing ...
-
bioRxiv - Genetics 2023Quote: ... using the FastStart Universal SYBR Green Master Mix (Roche, Indianapolis, Indiana). The following PCR cycle was used for all RT-qPCR experiments ...
-
bioRxiv - Genomics 2023Quote: ... and the LightCycler 480 SYBR Green I Master mix (Roche 04887352001). The mean relative expression of technical replicates of each sample was measure by the CFX Manager software (Bio-Rad ...
-
bioRxiv - Plant Biology 2023Quote: ... 200 nM primers and KAPA SYBR FAST master mix (KAPA Biosystems). RT-qPCR reactions and were performed on a 7500 Fast Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2024Quote: ... with SYBR Green 2× PCR Master Mix I (Roche, Cat# 04887352001) and 1 μM of forward and reverse primer respectively ...
-
bioRxiv - Microbiology 2024Quote: ... using KAPA Sybr Fast Universal qPCR master mix (Kapa biosystems (#KK4602). Mean strain DNA quantities were calculated using a standard curve to determine relative abundance of S ...
-
bioRxiv - Molecular Biology 2024Quote: ... the purified DNA was mixed with SYBR Green master mix (Roche) and specific primers ...
-
bioRxiv - Biochemistry 2024Quote: ... and KAPA Universal qPCR Master Mix (KAPA Biosystems, KK4824/Roche 07960140001). The products were pooled as equimolar and subjected to deep sequencing using NovaSeq (Illumina).
-
bioRxiv - Biochemistry 2024Quote: ... and KAPA Universal qPCR Master Mix (KAPA Biosystems, KK4824/Roche 07960140001). The products were pooled as equimolar and subjected to deep sequencing using MiniSeq (Illumina).
-
bioRxiv - Biochemistry 2024Quote: ... and KAPA Universal qPCR Master Mix (KAPA Biosystems, KK4824/Roche 07960140001). The products were pooled as equimolar and subjected to deep sequencing using MiniSeq (Illumina).
-
bioRxiv - Biochemistry 2024Quote: ... and KAPA Universal qPCR Master Mix (KAPA Biosystems, KK4824/Roche 07960140001). The products were pooled as equimolar and subjected to deep sequencing using NovaSeq (Illumina).
-
bioRxiv - Cancer Biology 2024Quote: qPCR reactions containing 1X KAPA SYBR Fast qPCR Master Mix (Roche), transcript-specific primers ...
-
bioRxiv - Systems Biology 2020Quote: The PCR mix was prepared with 110 μL of 2x Kapa HiFi HotStart ReadyMix (Roche), 8.8 μL of PCR_PF (10 μM) ...
-
bioRxiv - Neuroscience 2020Quote: ... Reactions included 12.5 μL of the 2X KAPA Hifi Hot Start Ready Mix (Kapa Biosystems), 5 μL each of the forward and reverse primers at 1 μM ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primer2: 5’-CAAGCAGAAGACGGCATACGA*G-3’) and 15µl 2x Kapa HiFi HotStart Ready Mix (Kapa Biosystems), amplification was performed for 45 s at 98°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... to amplify the ligation product with 5 PCR cycles using 2x KAPA-HiFi HS Ready Mix and 10X KAPA primer mix (Roche Kapa Biosystems). The libraries were sequenced on HiSeq 4000 or NovaSeq 6000 (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: ... Each sample was run in 20 μL reaction using 2X FastStart Universal Probe Master with ROX (Roche). Reactions were performed in an ABI real-time PCR 7500 (Applied Biosystems ...
-
bioRxiv - Microbiology 2019Quote: Each real-time PCR reaction contained 1x Roche universal probe library (UPL) master mix (LightCycler 480 Probes Master, Roche), 80 nM UPL hydrolysis probe ...
-
bioRxiv - Developmental Biology 2021Quote: ... using LightCycler 480 SYBR Green I Master mix (Roche Holding AG, 04887352001). Relative expression was calculated using the ΔΔCt method ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and quantified using the KAPA SYBR FAST qPCR Master Mix (Kapa Biosystems) on a Bio-Rad CFX machine ...
-
bioRxiv - Immunology 2022Quote: ... qReal-time PCR was performed using SYBR Green FastStart Master Mix (Roche) in the CFX Connect Real-time PCR detection system (Bio-Rad) ...
-
bioRxiv - Genetics 2019Quote: ... and quantified using the KAPA SYBR FAST qPCR Master Mix (Kapa Biosystems) on a Bio-Rad CFX machine ...
-
bioRxiv - Neuroscience 2019Quote: qPCR was performed with LightCycler 480 SYBR Green I Master mix (Roche) in a LightCycler 480 II System (Roche ...
-
bioRxiv - Neuroscience 2019Quote: ... qPCR was performed using FastStart SYBR green master mix (Roche applied science) in a 7500 Fast real-time PCR machine (Applied Biosystem ...
-
bioRxiv - Molecular Biology 2019Quote: ... qPCR was performed using Light Cycler 480 SybrGreen Master Mix (Roche, 04887352001) and analysed using Light Cycler 480 Software 1.5 (Roche) ...
-
bioRxiv - Neuroscience 2019Quote: ... using the following reaction mixtures: 1× LightCycler 480 HRM master mix (Roche), 2mM MgCl2 ...
-
bioRxiv - Cell Biology 2019Quote: ... Dot1L transcript abundance was measured by qPCR using SYBRgreen master mix (Roche) and the LightCycler 480 II (Roche) ...
-
bioRxiv - Molecular Biology 2019Quote: ... qPCR was performed with KAPA SYBR FAST qPCR Master Mix (Kapa Biosystems) and amplified on a 7900HT Real-time PCR machine (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2019Quote: ... qRT–PCR was performed using FastStart Universal SYBR Green Master mix (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µL LightCycler 480 SYBR Green I Master Mix (Roche Applied Science) and 1 µL (3 µM ...
-
bioRxiv - Microbiology 2020Quote: ... Genes were amplified using oligos FastStart Essential DNA Green Master Mix (Roche) per manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... Light Cycler SBYR green 480 Master Mix (Roche LifeScience, Product No. 04707516001) and the specific primers (Table 2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was performed using KAPA SYBR FAST qPCR Master Mix (KAPA Biosystems) and a Real-Time PCR Detection System (Bio-Rad) ...
-
Comprehensive fitness landscape of SARS-CoV-2 Mpro reveals insights into viral resistance mechanismsbioRxiv - Molecular Biology 2022Quote: ... and quantified using the KAPA SYBR FAST qPCR Master Mix (Kapa Biosystems) on a Bio-Rad CFX machine ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library enrichment was done using KAPA HiFi Uracil+ master mix (Kapa Biosystems) and the following PCR condition was used ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... FastStart Universal SYBR Green Master mix was from Roche (Indianapolis, IN, USA).
-
bioRxiv - Cancer Biology 2021Quote: ... master mix was used to quantitate cDNA with a LightCycler 480 (Roche). An initial 95°C for 5 minutes was followed by 45 cycles of amplification using the following settings ...