Labshake search
Citations for Roche :
401 - 450 of 816 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... and resuspended in 25μL ice cold ATAC-RSB buffer (10mM Tris-HCl, pH 7.4, 10mM NaCl, 3mM MgCl2, 0.1% NP40 (Roche cat#11332473001)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... In a 50 μl-reaction the concentrated DNA (15 μl) was mixed with 10 μl of the Nextera index mix (i5 + i7) and 2x Kapa HiFi Master Mix (Roche). The PCR was performed in a Thermocycler (Eppendorf mastercycler ...
-
bioRxiv - Biochemistry 2019Quote: ... The cells were then pelleted again and resuspended in 150 μL of Lysozyme buffer (150 mM NaCl, 30 mM Tris–HCl pH 8, 10 mM EDTA, cOmplete protease inhibitor (Roche), 1 mg/ml lysozyme ...
-
bioRxiv - Physiology 2021Quote: ... and 400 ml of sample was placed in a 2-l wide-mouthed Erlenmeyer culture flask with 100 ml of freshly prepared blendzyme (Roche Liberase TM ...
-
bioRxiv - Plant Biology 2021Quote: ... The construct was used to transform wild type plants following the standard floral dip method (Clough and Bent, 1998) and selected with 50 mg L-1 Hygromycin (Roche). A total of 60 T1 plants were individually genotyped by PCR and sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: 160 μl DMEM containing 10 % FBS were added to the bottom wells of xCELLigence Real-Time Cell Analyzer CIM plate (Roche), as chemo-attractant ...
-
bioRxiv - Neuroscience 2019Quote: DIV14-15 cortical neurons (250.000 neurons/mL in laminin/poly-L-ornithine coated 6-well plates) were washed and scraped with ice cold PBS with protease inhibitor cocktail (Roche). Neurons were pelleted (5 minutes at 3000 g at 4°C) ...
-
bioRxiv - Microbiology 2019Quote: ... cellular pellets were suspended in 10 mL of Buffer 1X supplemented with 2 mM (L+D) 1,4-Dithiothreitol (DTT) and cOmplete™ mini protease inhibitor cocktail (Roche). To avoid overheating and protein denaturation ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.78 g/L CSM-His and 20 g/L agar) and screened for expression of Erg6-GFP by Western blot with anti-GFP bodies (11814460001; Roche) and for localization of Erg6-GFP to LDs by fluorescence microscopy.
-
bioRxiv - Developmental Biology 2021Quote: ... brn3a1 and brn3a2(l) transcripts were visualized with anti digoxigenin-alkaline phosphatase conjugates and BCIP/NBT or BM purple substrates (Roche). For two color WISH krx-20 (Oxytoby and Jowett ...
-
bioRxiv - Genetics 2021Quote: ... The cultures were spun down and cell pellets were resuspended in 500 μL of Workman Extract Buffer (40mM HEPEs pH7.4, 250mM NaCl, 0.1% NP40, 10% Glycerol, 1 mM PMSF, Roche proteinase inhibitors). 250 μL of glass beads were added and cells were lysed with Peqlab precellys homogenizator (3×30 sec) ...
-
bioRxiv - Plant Biology 2021Quote: ... Two µL of diluted cDNA was used as a template for the qRT-PCR with Fast SYBR Green Master Mix (Roche) on a Light-Cycler 96 instrument (Roche ...
-
bioRxiv - Immunology 2020Quote: ... The mucosa was stripped and dissociated in GentleMACS tubes in digestion medium (DM; complete medium (RPMI 1640 with PGA/L-glutamine/10% FCS) with 1 mg/mL Collagenase D (Roche), 1 mg/mL soybean Trypsin inhibitor (Sigma) ...
-
bioRxiv - Plant Biology 2021Quote: ... water was exchanged for 100 µL water with 5 µM L-012 (WAKO chemicals) and 2 µg/mL horseradish peroxidase (Type II, Roche). After the leaf discs were treated with 1 µM 3-OH-C10:0 (stock in MeOH ...
-
bioRxiv - Cancer Biology 2022Quote: 1 μL amplified cDNA library was used as template in a 29-cycle PCR reaction using KAPA HiFi HotStart ReadyMix (Roche). To avoid possible PCR-induced library biases ...
-
bioRxiv - Microbiology 2022Quote: ... The solution was incubated for 20 min at 37°C and 15 μl of proteinase K (20 g L-1l; Roche) was added ...
-
bioRxiv - Microbiology 2022Quote: ... A cell pellet was resuspended in 250 μL Tris-EDTA buffer and 50 μL 30 g L-1 lysozyme (Roche) in Tris-EDTA buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Ovaries were cut into 6-8 pieces and enzymatically digested in L-15 media containing Liberase TM (Roche, Indianapolis, IN) and DNase I (Worthington Biochemicals ...
-
bioRxiv - Plant Biology 2024Quote: ... The transformants were screened on MS plants with 1% sucrose and 0.8% agar containing 40mg/L hygromycin (Roche, no. 10843555001). For each construct ...
-
bioRxiv - Genomics 2024Quote: ... or 3 µl of direct lysis extract were used as template in 50 µl PCR reactions using KAPA HiFi HotStart ReadyMix (Roche), primers P3/4 and P5 (Supplementary Table 2) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the supernatant was removed and the pellet was resuspended in 250 µL of Galbraith buffer pH 7.0 plus 0.1% Triton X-100 and 1x cOmplete Protease Inhibitor Cocktail (Roche, Mannheim, Germany). 50 µL of 0.2 µm glass beads were added and samples were vortexed for 3 minutes to smash open spores and release nuclei ...
-
bioRxiv - Molecular Biology 2023Quote: ... 25 μL 1 M spermidine, 500 µL 10% Triton X-100, and 10 ml glycerol in 38 ml dH2O, 1 Roche Complete Protease Inhibitor EDTA-Free (Millipore Sigma 11873580001)) ...
-
bioRxiv - Immunology 2023Quote: ... 1 vial dissolved in 5mL HBSS to yield 20U of papain/mL in 1mM L-cysteine with 0.5mM EDTA) and 1mg/mL DNAse I (Roche 10104159001) with curved scissors ...
-
bioRxiv - Immunology 2023Quote: ... 0.5 –1 L of the crude lysates were treated with 5 mg/mL each of DNase I and RNAse (Roche) for one hour at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... blocked for 1 h in blocking reagent (100 mM Tris HCL pH 8; 150 mM NaCL; 5 g/L Blocking Reagent (#11096176001, Roche)) and treated for 1.5 h with primary antibody diluted in blocking reagent (NF-κB p65/RELA ...
-
bioRxiv - Bioengineering 2023Quote: ... The construct was synthesized by GenScript® and the plasmid was used as template for PCR amplification (Kapa Hifi Hotstart Ready Mix, Cat#F-530-L, Roche). The PCR amplicon was purified with NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel ...
-
bioRxiv - Genomics 2023Quote: ... were put on ice for 15min then resuspended in 250μl chilled douncing buffer (10mM Tris-HCl pH7.5, 4mM MgCl2, 1mM CaCl2) with 1X Protease Inhibitory Cocktail (PIC, Roche 5892791001). Cells were homogenized through a 1ml 25g 5/8 syringe for 20 times and kept on ice ...
-
bioRxiv - Biochemistry 2023Quote: ... were used to inoculate each well of a 96-well plate containing 196 μL of LB media (supplemented with ampicillin, and 200uM IPTG) The plate was covered with transparent LightCycler480 Sealing Foil (Roche), and grown for 24 h in a Biotek Synergy H1 plate reader at 42 °C with double orbital shaking ...
-
bioRxiv - Neuroscience 2024Quote: ... The cell pellet was resuspended (20 mL/L culture volume) in lysis buffer (20 mM Tris pH 8, 150 mM NaCl, and protease inhibitor cocktail, Roche). These resuspended cells were disrupted using sonication (QSonica sonicator ...
-
bioRxiv - Genetics 2024Quote: ... The 5μl total volume reaction was loaded in 384-well plates and was performed in a LightCycler 480 Instrument II (Roche), using a cycling program of ...
-
bioRxiv - Immunology 2024Quote: ... LNs obtained from organ donors were submerged in 5 mL R10 media (RPMI + 10% FBS + 1% penicillin/streptomycin + 2mM L-glutamine) supplemented with 10U/mL DNase I (Roche), cleaned of visceral fat ...
-
bioRxiv - Cell Biology 2019Quote: ... 3) 2hr RT incubation in blocking solution (5% Sheep Serum, 1% Roche Blocking Buffer in PBST); 4 ...
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Neuroscience 2019Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) substrate (Roche Diagnostics). Color development was allowed to proceed overnight or was stopped after 2-3 hours (for quantification of npba expression in Vs/Vp ...
-
bioRxiv - Neuroscience 2020Quote: ... The colometric reaction was performed using mixture of 5-Bromo-4-chloro-3-indolyl phosphate (Roche) and Nitro blue tetrazolium chloride (Roche).
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Plant Biology 2021Quote: ... and BCIP (5-Bromo-4-chloro-3-indolyl phosphate)-NBT (nitro blue tetrazolium) chromogenic substrates (Roche). Images were captured by Apotome2 Zeiss microscope system.
-
bioRxiv - Cell Biology 2022Quote: ... HeLa cells were reverse transfected with 1:3 or 1:6 X-tremeGENE 9™ (Roche) transfection reagent according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
Liver X Receptor activation regulates genes involved in lipid homeostasis in developing chondrocytesbioRxiv - Physiology 2019Quote: ... This was followed by a 1.5-2 hour incubation in Collagenase-P (3 mg/mL, Roche) diluted in Dulbecco’s Modified Eagles Medium (DMEM ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’UTRs and 3’UTRs amplifications were performed using either Expand High Fidelity PCR System (Roche) or KAPA HiFi PCR system (KAPA Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... washed in FACS buffer (4% FBS, 3 mM EDTA, and 40 μg/ml DNAse I (Roche)) and incubated with combinations of antibodies to CD45 (30-F11) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl of 10% SDS and 5 μl of 10 mg/ml Proteinase K (Roche, #31158) were added and incubated at 50 °C for 1 h ...
-
bioRxiv - Physiology 2024Quote: ... with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 1 hour (gal) ...