Labshake search
Citations for Roche :
201 - 250 of 816 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 3% bovine serum albumin (Roche Diagnostics, Meylan, France) and 1.3 mg/ml collagenase A (Merck ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate solution (Roche). Images were captured using a BX-50 microscope (Olympus Corp. ...
-
bioRxiv - Neuroscience 2023Quote: ... #11383213001)/BCIP (5-bromo-4-chloro-3-indolyl phosphate, Roche, #11383221001) color development substrate via AP activity ...
-
bioRxiv - Developmental Biology 2023Quote: Dissected embryos were incubated with a liberase-blendzyme 3 (Roche) solution for 90min at 33 °C ...
-
bioRxiv - Genomics 2020Quote: ... all multiplexed single-cell libraries (n = 30) were quantified using the KAPA Library Quantification Kit for Illumina Platforms (Roche) and pooled in an equimolar ratio ...
-
bioRxiv - Molecular Biology 2021Quote: ... the supernatant was incubated for o/n with 40μl of anti-HA agarose beads (rat anti-HA, 3F10 Roche) at 4 °C ...
-
bioRxiv - Plant Biology 2021Quote: ... 20 μg of total RNA was separated on a denaturing 1.2% agarose gel and blotted on a Hybond-N+ (Roche) membrane ...
-
bioRxiv - Microbiology 2020Quote: ... separated by electrophoresis in a 0.8% agarose gel and transferred onto a nylon membrane (Hybond N+, Roche Molecular Biochemicals). The membrane was hybridized with digoxigenin-labeled DNA probes synthesized with a PCR DIG probe synthesis kit (Roche Molecular Biochemicals ...
-
bioRxiv - Neuroscience 2019Quote: ... some TK rats (n=11) were orally administered 4 mg of valganciclovir (val) to reduce neurogenesis (Hoffman La-Roche; delivered in 0.5 g peanut butter + chow pellets ...
-
bioRxiv - Developmental Biology 2020Quote: ... Whole cells extract was isolated using RIPA buffer (NaCl 150mM – Tris HCL pH7,35 50mM – DOC 1% – N-P40 1% – H2O) supplemented with protease inhibitor (04 693 116 001, Roche). Isolated protein concentration was determined using Bradford assay (500-0006 ...
-
bioRxiv - Genetics 2020Quote: ... pellets were thawn and re-suspended in 400 μl of lysis buffer (50mM HEPES pH7.5, 150mM NaCl, 5mM MgCl2, 40mM N-Ethylmaleimide, EDTA-free protease inhibitor cocktail (Roche) and 2mM PMSF (Sigma) ...
-
bioRxiv - Microbiology 2024Quote: ... with their respective dilution in 5% skimmed milk in PBS-tween 0.1% were used: anti-HA-HRP (3F10) (N°12013819001, Roche) 1/10,000 ...
-
bioRxiv - Cell Biology 2021Quote: Using serum-free media supplemented with 5 g/l BSA fraction V (Roche, #107351080001), islets were pre-treated with 100 nM CCK ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 1 mmol/L β-glycerophosphate) and protease inhibitors (Protease Inhibitor Cocktail Tablets, Roche). Protein concentration was determined using a Bradford Protein Assay Kit (Bio-Rad) ...
-
bioRxiv - Neuroscience 2022Quote: ... L-lactate accumulated in the medium was detected using a Cobas c311 Analyser (Roche). Secondly ...
-
bioRxiv - Immunology 2024Quote: ... 2 mM L-Glutamine (R10) (Thermo 25030081) + 10 IU/mL IL-2 (Roche 11011456001) after CD3/CD28 stimulation ...
-
bioRxiv - Genomics 2023Quote: First-round L-PCRs were performed using KAPA HiFi HotStart ReadyMix (Roche Molecular Systems). Reactions (50 μl ...
-
bioRxiv - Neuroscience 2024Quote: ... The cells were washed in L-15 medium with 40 μg/ml DNaseI (Roche) and transfected with 2 μg plasmid DNA using the 4D- Nucleofector (Lonza) ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM phenylmethanesulphonylfluoride (PMSF) and complete Mini protease inhibitor cocktail (Roche). Following lysis ...
-
bioRxiv - Neuroscience 2021Quote: ... and 5’-GCTTGAGGTAGC CCTGTTGTCACC-3’ using KAPA HiFi Hotstart polymerase (Roche:KK2602). This PCR reaction produced a 185 bp wild type band and a 750 bp knockout band in heterozygous animals ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA (1 μg) was mixed with 3 μl Fugene6 (Roche, #11836145001) in 200 μl opti-MEM (Gibco ...
-
bioRxiv - Molecular Biology 2020Quote: ... then equilibrated for 3 min in detection buffer (Roche, Catalog# 11585762001). Signals were visualized with CDP-Star Ready-to-Use (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... and BCIP (1,5-bromo-4-chlooro-3-indolyl-phosphate, Roche, Switzerland).
-
bioRxiv - Developmental Biology 2022Quote: ... and 0.035 mg/ml 5-bromo-4-chloro-3-indolyphosphatase (Roche). Images were acquired by the Leica MZ10F microscope with the DS-Ri1 camera.
-
bioRxiv - Physiology 2022Quote: ... pH 7.4) containing 3 mg/mL collagenase A (Roche Diagnostics, Germany). Oocytes of stage IV and V were manually defolliculated and each oocyte was injected with 50-100 ng of mRNA encoding for the respective photoreceptor CNG channels ...
-
bioRxiv - Immunology 2019Quote: ... After blocking for 1 hour in 3% Bovine Serum Albumin (Roche) in TBS-T ...
-
bioRxiv - Neuroscience 2019Quote: ... and was subsequently digested with 3 mg/mL Collagenase/Dispase (Roche) in PBS (1X ...
-
bioRxiv - Neuroscience 2023Quote: ... with 3 mg/mL DNAse I grade II (Roche, Cat# 104159). The cell suspension was centrifuged at 1,300 rpm for 5 minutes with 7.5% BSA solution (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... in HEPES buffer containing Liberase Blendzyme 3 (70 mg/ml; Roche) and DNaseI (30 mg/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP; 11383221001, Roche) was performed in alkaline phosphatase reaction buffer [100 mM Tris pH 9.5 ...
-
bioRxiv - Cell Biology 2023Quote: MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay (Roche) was performed following manufacturer’s indications ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5’-AGCGTTCACATCATATGGCA-3’) using Taq DNA polymerase (Roche, Cat. No. 11146165001). Fragments of foxl2l and id1 were cloned into pGEMT-easy plasmid by TA cloning while nanos2 fragment was cloned into pCS2+ plasmid by BamHI and KpnI ...
-
bioRxiv - Neuroscience 2023Quote: ... and BCIP (5-bromo-4-chloro-3-indolyl-phosphate, Roche 11383221001). Larvae were mounted in 100% glycerol under coverslips and bright-field images captured using a Leica DFC500 camera mounted on a Zeiss Axioskop
-
bioRxiv - Biochemistry 2023Quote: ... and 3 cOmpleteTM mini EDTA-free Protease Inhibitor cocktail tablets (Roche)) ...
-
bioRxiv - Immunology 2023Quote: ... Fat was digested enzymatically with 3 mg/ml collagenase/dispase (Roche) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... followed by overnight digestion with 3 U PNGase F (Roche diagnostics) at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... Animals were injected with diazepam (3 mg/kg, Roche Pharmaceuticals, CH), gaboxadol (10 mg/kg ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 mM CaCl2 and protease inhibitor cocktail (CompleteTM EDTA-free, Roche), and homogenized by 10 strokes using Dounce device ...
-
bioRxiv - Developmental Biology 2024Quote: ... Nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (Roche) and Fast Red (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... Southern blotting was carried out using Hybond-N+ membrane (Amersham) and DIG High Prime DNA Labeling and Detection Starter kit II (Roche), following the indications of the manufacturer ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Cell Biology 2020Quote: Cells were pelleted and lysed with 1.5% n-dodecyl-D-maltoside (DDM) in PBS with cOmplete™ protease inhibitor (Roche) for 15 min on ice ...
-
bioRxiv - Genetics 2021Quote: ... and Tvrm323 mice (n = 4) eyes at one month of age were dissected in ice- cold PBS with proteinase inhibitor (Roche) and snap frozen in eppendorf tubes on dry ice.
-
bioRxiv - Molecular Biology 2021Quote: ... lysate supernatant from cells expressing N-terminal 6-His-tagged proteins were incubated with nickel-nitrilotriacetic acid (Ni-NTA) cOmplete His-tag purification resin (Roche) for 1 h at 4° C ...
-
bioRxiv - Cell Biology 2019Quote: ... ground yeast powder was solubilized in 4 volumes of homogenization buffer (400 mM trisodium citrate, pH 8, 0.5% n-Dodecyl β-D-maltoside) and protease inhibitor cocktail (Roche). The soluble fraction was incubated with 10 μl magnetic beads (Dynabeads ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were seeded subconfluently o/n (unless indicated otherwise) onto coverslips acid-washed and coated with human fibronectin (25 μg/ml, #11051407001, Roche), as described (Dimchev and Rottner ...
-
bioRxiv - Immunology 2020Quote: ... The treated samples were purified using a C18 cartridge (Oasis HLB Plus Waters) prior to the release of N-glycans by PNGase F (recombinant from Escherichia coli, Roche) digestion ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were then washed with PBS and lysed in HEPES buffer supplemented 100 μM N-ethylmaleimide and protease inhibitor cocktail (Roche). The lysates were centrifuged and incubated with 2 μg Mcl-1 antibody (S-19 ...
-
bioRxiv - Immunology 2022Quote: ... and 11-week infected half brains and liver lobes of mice (n=4/group) was extracted and purified using a High Pure PCR Template Prep Kit (Roche). DNA concentration of each sample was determined via NanoDrop ...
-
bioRxiv - Neuroscience 2022Quote: cDNA was generated from TRAP-isolated and total input RNA samples (n=2 samples/group) using the Transcriptor First Strand cDNA Synthesis Kit (Roche) following the manufacturer’s instructions ...