Labshake search
Citations for Roche :
551 - 600 of 816 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... and single-cell suspensions of lung mononuclear cells were prepared by Liberase Blendzyme 3 (70 ug/ml, Roche) digestion containing DNaseI (30 µg/ml ...
-
bioRxiv - Immunology 2024Quote: ... Mouse lungs were excised and lightly homogenized in HEPES buffer containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNaseI (30 μg/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 µL egg extract was diluted in 16.5 µL reaction buffer (80 mM β-glycerophosphate, 20 mM EGTA, 15 mM MgCl2, 10 uM okadaic acid, 1x protease inhibitor (Roche, cOmplete #11873580001), 100 µM ATP ...
-
bioRxiv - Genomics 2020Quote: ... 2 g of DUX4 expression constructs were transfected into RD cells with 6 L of the X-treme GENE 9 DNA transfection reagent (cat. XTG9-RO, Roche Diagnostics, Indianapolis, USA) diluted in 100 L of Opti-MEM I (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3 μm sections from the TMA-2 human adenocarcinoma cohort were duplex stained using a Ventana autostainer with antibodies for cytokeratin AE1/AE3 (1:250, #NCL-L-AE1/AE3, Leica detected with Roche discovery yellow chromogen) and SOX9 (1:10000 ...
-
bioRxiv - Plant Biology 2022Quote: ... 10 µl of adapter ligated DNA from each genotype was used along with 25 µl 2x KAPA HiFi HotStart ReadyMix (Kapa Biosystems, MA, USA), 1 µl Index and Universal PCR Primer and 13 µl water ...
-
bioRxiv - Genomics 2020Quote: ... resuspended in 10 μl of 10 mM tris-HCl (pH = 8.5) and quantified using qPCR with the KAPA Library Quantification Kit (Roche Diagnostics, Diegem, Belgium, KK4854) according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... The final pellet was resuspended in 150 μl of NTE buffer (137 mM NaCl, 1 mM EDTA, 10 mM Tris, pH 7.4) with protease inhibitor (Roche, cOmplete Mini tablets, 4693159001). In ultracentrifugation library experiments ...
-
bioRxiv - Clinical Trials 2019Quote: ... participants were given orange juice (with or without 100/25 mg of L-dopa/benserazide, trade name: Madopark® Quick mite. Roche, Basel, Switzerland) by a nurse who was masked to the group specification ...
-
bioRxiv - Neuroscience 2022Quote: ... the dishes were placed on ice and 500 μl of homogenization buffer (HB; 0.32 M sucrose and one tablet Complete mini EDTA-free protease inhibitor cocktail (Roche; 10 ml, pH 7.4)) (4°C ...
-
bioRxiv - Microbiology 2023Quote: ... 5 µl RNA eluate was used in a RVFV RT-qPCR using the LightCycler one-tube RNA Amplification Kit HybProbe (Roche, Almere, The Netherlands) in combination with a LightCycler 480 real-time PCR system (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mL of the culture was then treated with either 5 µl of MeOH or LMB dissolved in 7:3 MeOH:H2O solution (Roche) at a final concentration of 50 ng/mL for 45 min before imaging.
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were washed twice with 0.1% Triton-X in PBS and blocked with 3% BSA (constituted from powder BSA, Roche Fraction V ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5–10 × 106 HEK-293 or MEF cells were washed with cold sucrose-containing solution I (0.5 M sucrose, 3 mM MgCl2 with Cocktail protease inhibitor, Roche), harvested by scraping into 1 ml solution I and sonicated in a BioRuptor for 10 cycles (15 sec ON/15 sec OFF) ...
-
bioRxiv - Cell Biology 2019Quote: ... ∼100 µl glass beads and 100 µl of lysis buffer (50 mM Tris-HCl pH 8.0, 1 mM EDTA, 15 mM Tris pH 9.5, 3 mM DTT, 1X cOmplete EDTA-free inhibitor cocktail [Roche]) were added to each dried pellet ...
-
bioRxiv - Neuroscience 2019Quote: ... The plates were then washed 3 times with ~300 μl of wash buffer (0.05%Tween in PBS) and blocked with 150 μl of 3% BSA (Fraction V, protease-free, Roche Diagnostics Corporation ...
-
bioRxiv - Immunology 2021Quote: ... The pancreas was inflated via the common bile duct by adding ∼3 ml of 0.8mg/ml Collagenase P (Roche) and 10µg/ml Dnase I (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were then washed 3 times for 5 min each in PBST and blocked with 1X Blocking Reagent (Roche) in PBST ...
-
bioRxiv - Cell Biology 2021Quote: ... 12-20 ml of pre-warmed to 37 °C enzyme buffer solution (EBS) with 2.3 U of Liberase Blendzyme 3 recombinant collagenase (Roche) were cannulated into the vena cava to isolate hepatocytes ...
-
bioRxiv - Microbiology 2021Quote: ... 200 μg each lysate was pre-cleared with 20 μl of Protein A agarose beads (3 mg/ml, Roche) in 200 μl for 1 hour at 4°C on a Labquake Rotator (Barnstead Thermolyne) ...
-
bioRxiv - Cell Biology 2021Quote: ... The membranes were blocked with 3% skim milk in TBS for 30 minutes and then probed with mouse anti-GFP (1:1,000, Roche) or rabbit anti-aldolase (Mesén-Ramírez et al. ...
-
bioRxiv - Cell Biology 2020Quote: RACE-cDNA was synthesized according to the manufacturer’s protocol for 5’/3’ RACE Kit 2nd generation (Roche; Cat.No. 03353621001). The 2648-bp cDNA was cloned into the NheI-XhoI site in pcDNA 3.1 plasmid to obtain pcDNA3.1-DR5-AS and was verified by sequencing ...
-
bioRxiv - Cell Biology 2022Quote: ... The pellet was resuspended with 3 ml S1 solution (0.25 M sucrose, 10 mM MgCl2, 1x Complete protease inhibitor cocktail (Roche)) by pipetting up and down ...
-
bioRxiv - Neuroscience 2022Quote: ... and then reacted with 0.375 mg/mL nitroblue tetrazolium and 0.188 mg/mL 5-bromo-4-chloro-3-indolylphosphate (NBT/BCIP; Roche Diagnostics) for 27—42 h.
-
bioRxiv - Physiology 2022Quote: ... for 3 min and incubated twice for 3 min with CSK buffer containing 0.5% Triton X-100 and complete protease inhibitors cocktail (catalog no. 11873580001, Roche). Cells were after washed with PBS-S ...
-
bioRxiv - Developmental Biology 2020Quote: ... Sorted cells were pelleted for 5 min with 2000 rpm at 4°C and resuspended in 500 ul hypotonic buffer (HB; 20mM Tris-HCl, pH7.5, 10mM NaCl, 3 mM MgCl2) with added protease inhibitor (Roche). After 30min incubation on ice ...
-
bioRxiv - Biochemistry 2020Quote: ... 100 mM KCl, 1 mM MgCl2, 0.5 mM β-mercaptoethanol, 0.1 mM GTP, 3 U/ml benzonase, 1X Roche Complete EDTA-free protease inhibitor ...
-
bioRxiv - Cell Biology 2022Quote: ... and 100 µL protein breakage buffer (50 mM Tris-HCl pH 8.0, 1 mM EDTA, 20 mM Tris pH 9.5, 3 mM DTT, 1X cOmplete EDTA-free inhibitor cocktail [Roche]) were added to the samples ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were resuspended in buffer1 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Protease inhibitors (Roche)) and incubated for 20 min at 4°C ...
-
bioRxiv - Immunology 2020Quote: Mice were euthanized and lungs were gently homogenized in HEPES buffer containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNaseI (30 μg/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cell pellets resuspended in LB1 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2 supplemented with protease inhibitors [Roche]) for 5 minutes at 4 °C followed by centrifugation (1,000g ...
-
bioRxiv - Neuroscience 2020Quote: ... the beads were washed 3 × in washing buffer (20 mM Tris, 150 mM NaCl, 0.5 % Triton-X-100, complete protease inhibitor cocktail (Roche)) that was either substituted with 2 mM EGTA or 0.5 mM CaCl2 and 1 mM MgCl2 ...
-
bioRxiv - Neuroscience 2020Quote: ... then the beads were washed 3 × with washing buffer (20 mM Tris, 150 mM NaCl, 0.5 % Triton-X-100, complete protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Neuroscience 2020Quote: ... the beads were washed 3 × in washing buffer (20 mM Tris, 150 mM NaCl, 0.5 % Triton-X-100, complete protease inhibitor cocktail (Roche)) that was either substituted with 2 mM EGTA or 100 μM CaCl2 ...
-
bioRxiv - Genetics 2020Quote: ... These pieces were then added to 3-4 ml of digestion media containing 0.1 mg/ml Liberase (Roche, 501003280), 100 U/ml DNase I (Sigma ...
-
bioRxiv - Genomics 2021Quote: ... we blocked the slides for 1-hr using 3% BSA/PBS with 0.1% Tween and incubated slides with 1:200 secondary antibodies (Roche) in 3% BSA/4X SSC with 0.1% Tween and BSA at room temperature for 1 hr ...
-
bioRxiv - Plant Biology 2021Quote: ... in paraffin-embedded sections (8µm) and color was detected with 5-bromo-4-chloroindol-3-yl phosphate/nitrateblue tetrazolium (BCIP/NBT) (Roche).
-
bioRxiv - Genomics 2021Quote: ... followed by lysing the cells on ice for 3 min in 50 μl of ATAC-seq RSB containing 0.1% NP40 (Roche), 0.1% Tween-20 (Roche) ...
-
bioRxiv - Neuroscience 2022Quote: ... Myelin was washed by dilution in HBSS and centrifuged at 400 x g for 5 min at 4 °C before suspending in 3 mL ice cold 0.32 M sucrose solution containing protease inhibitor cocktail (Roche). Next ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were resuspended in buffer2 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Protease inhibitors (Roche), 0.5 % IGEPAL CA-630 ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 mL of Tris (pH = 8.5) and 3 tablets each of the protease/phosphatase inhibitors PhosStop and Complete Mini (Roche). Tissues were then lysed in Precellys Homogenizer Bertin (program 6 x 20s pulse ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected according to the manufacturer’s protocol at a µL lipofectamine: µg plasmid ratio of 3:1 (X-tremeGENE 9, Roche). After 48 hours ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were resuspended in 1000 µL cold cytoplasmic lysis buffer (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Microbiology 2023Quote: ... cells were resuspended in 1000 µL cold sucrose buffer containing (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Physiology 2023Quote: ... according to the manufacturer’s protocol and were transcribed into cDNA with the 2nd generation 5’/3’ RACE Kit (Roche) in combination with the Expand High Fidelity PCR System (Roche ...
-
bioRxiv - Plant Biology 2023Quote: ... except that 2 g of fresh weight whole seedlings were harvested for each genotype (3 biological replicates each) and 1.5 ug of anti-HA 3F10 (Roche) antibody were used for immunoprecipitation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Data from 2-3 technical replicates for all three biological replicates were analyzed in LightCycler® 96 software (Roche), Google Sheets ...
-
bioRxiv - Neuroscience 2024Quote: ... Ganglia were then treated for 20 min at 37°C with 3 mg/ml collagenase (type I; Roche Diagnostics) and 3 mg/ml dispase II (Roche Diagnostics ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 mM magnesium chloride) supplemented with 1 cOmplete protease inhibitor cocktail tablet per 50 ml of lysis buffer (Roche) and mechanically disrupted in a Dounce homogenizer ...
-
bioRxiv - Molecular Biology 2024Quote: ... the “tracrRNA U6.3 promoter” fragment was amplified with left (AAGATATCCGGGTGAACTTCGN19GTTTTAGAGCTAGAAATAGC) and right (GCTATTTCTAGCTCTAAAACN19CGACGTTAAATTGAAAATAGG) sgRNA primers from pUC 3GLA U6.1/3 sgRNA using Pwo polymerase (Roche) with initial 30 sec denaturation at 94°C followed by two cycles 94°C/30 sec ...