Labshake search
Citations for Roche :
4251 - 4300 of 5469 citations for Rat BMP7 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... and 2 μg of total RNA was retro-transcribed using Transcriptor First Strand cDNA Synthesis Kit (Roche; Cat #04897030001) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... Eluted mRNA was then reverse transcribed using random hexamer primers and Transcriptor First Strand cDNA Synthesis Kit (#04897030001, Roche) at 65°C for 10 min ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was isolated from A549 cells under different treatment conditions using the High Pure RNA Isolation Kit (Roche), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... Cell death was evaluated separately using the Fluorescence In Situ Cell Death Detection kit (Roche Diagnostic, Indianapolis, IN, US). Brain sections were analyzed for DNA strand breakage using Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL ...
-
bioRxiv - Developmental Biology 2024Quote: ... Digoxigenin labeled antisense riboprobes were synthesized by in vitro transcription using a DIG RNA labeling kit (Roche, Cat#11277073910), followed by purification using Micro Bio-Spin P-30 gel columns (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA was purified with High Pure Viral Nucleic Acid Kit according to the manufacturer’s instruction (ROCHE, Mannheim, Germany). Viral RNA was amplified by LightMix® Modular Sarbecovirus E-gene (Roche ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 ng of amplified cDNA was used to prepare libraries with the KAPA Hyper Prep Kit (Kapa Biosystems, #KK8504) using 8 cycles of PCR ...
-
bioRxiv - Microbiology 2024Quote: ... Libraries were constructed from approximately 100 ng of genomic DNA using the Kappa HyperPrep Kit (Roche, Pleasanton, CA, USA) with mechanical shearing (Covaris ...
-
bioRxiv - Developmental Biology 2024Quote: ... DNA fragmentation was visualized by using an in situ cell death detection kit (Fluorescein; Cat #, 11684795910; Roche, Basel, Switzerland) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2024Quote: ... The total RNAs were converted into individually barcoded polyadenylated RNAseq libraries with the Kapa HyperPrep mRNA kit (Roche, CA), with prior removal of rRNAs with the FastSelect Bacteria kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... pre-capture libraries were prepared from up to 100 ng of input DNA using the KAPA Hyperplus kit (Roche) and TruSeq adapters and barcoded primers (Illumina) ...
-
bioRxiv - Evolutionary Biology 2024Quote: A PCR free library was prepared following the Kapa Hyper Prep Kit procedure provided by Roche (Roche, Basel, Switzerland). The library was sequenced on a paired-end mode with an Illumina NovaSeq 6000 instrument (Illumina ...
-
bioRxiv - Plant Biology 2020Quote: ... The first-strand cDNA was synthesized from 2 μg of total RNA with an anchored-oligo (dT)18 primer using the Transcriptor High Fidelity cDNA Synthesis Kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... and the powder was solubilized in the native extraction buffer supplied in the kit with addition of Complete Protease Inhibitor Cocktail (Roche). After incubation on ice for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... Southern blotting was carried out using Hybond-N+ membrane (Amersham) and DIG High Prime DNA Labeling and Detection Starter kit II (Roche), following the indications of the manufacturer ...
-
bioRxiv - Cancer Biology 2021Quote: ... Reverse transcription was done with the first Strand synthesis kit (Fermentas) using oligo (dT)18 as a primer and qPCR was carried out with LightCycler 96 (Roche) using GAPDH.
-
bioRxiv - Cancer Biology 2021Quote: ... MCF-7 shRNA and MCF-7 shFTH1 as well as H460 shRNA and H460 shFTH1 using the High Pure RNA isolation kit (Roche) according to the manufacturer’ ss instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... was used as the template to create the Scx mRNA probe by utilizing the DIG RNA Labeling Kit Catalog #11175025910 (Roche) and the T3 RNA polymerase Catalog #11031163001 (Roche) ...
-
bioRxiv - Cell Biology 2020Quote: ... Target regions were amplified by using specific PCR primers (ETV2_F: CACTCGGGATCCGTTACTCC; ETV2_R: GTTCGGAGCAAACGGTGAGA, KDR_F: CAAGCCCTTTGTTGTACTCAATTCT; KDR_R: ATTAATTTTTCAGGGGACAGAGGGA) and KAPA HiFi HotStart PCR kit (KAPA Biosystems, Cat No. KK2601). Sanger sequencing (Genewiz ...
-
bioRxiv - Cell Biology 2020Quote: The RNA probes were transcribed with the T7 polymerase and labeled using the DIG RNA labeling kit (Roche Cat # 11175025910). After the labeling reaction was complete ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell viability was assessed by addition of 5 μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (i.e., MTT) using a Cell Proliferation Kit I (Roche Diagnostics, Mannheim, Germany), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... were performed with the Ventana Bench-Mark XT automated staining system (Ventana) using the UltraView Universal DAB Detection Kit (Roche). For α-Syn ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA probes were created from in vitro transcription of PCR products carrying the T7 RNA polymerase recognition sequence at one end and synthesized by using a digoxigenin (Dig)-labeling kit (Roche). Wing discs of L3 larvae were hybridized with probes overnight at 56 °C using standard procedures and visualized using anti-Dig-AP (1:1,000 ...
-
bioRxiv - Microbiology 2020Quote: ... Both the pET28a vector and the Rv1630 gene amplification product (1446 bp) were purified using the PCR quick spin kit (Roche) following the manufacturer’s protocol ...
-
X-linked palindromic gene families 4930567H17Rik and Mageb5 are dispensable for male mouse fertilitybioRxiv - Genetics 2021Quote: ... Final libraries were quantitated by Kapa qPCR using Kapa’s library quantification kit for Illumina sequencing platforms (Kapa Biosystems, catalog # KK4835). Pooled libraries were subjected to 150 bp paired-end sequencing according to the manufacturer’s protocol (Illumina NovaSeq6000 ...
-
bioRxiv - Genetics 2021Quote: ... For whole-genome sequencing DNA was extracted using the MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche Diagnostics GmbH).
-
bioRxiv - Developmental Biology 2021Quote: ... Digxigenin (DIG)-labeled sense and antisense probes were performed from the linearized pGEM-T-easy plasmids using the DIG RNA Labeling Kit (Roche).
-
bioRxiv - Microbiology 2020Quote: ... and via real-time quantitative polymerase chain reaction (qPCR) with the KAPA Library Quantification Kit (Kapa Biosystems, Wilmington, MA, USA). Final library pools were spiked with a non-indexed PhiX control library (Illumina ...
-
bioRxiv - Microbiology 2019Quote: ... To determine the viral load by RT-qPCR RNA was extracted from apical washes (High Pure Viral RNA kit, Roche). cDNA was prepared using 10 µL RNA (High Capacity cDNA Reverse Transcription kit ...
-
bioRxiv - Developmental Biology 2021Quote: Mice ear notches or embryo tail tips were genotyped by PCR using Kapa2G Robust HotStart PCR Kit (Kapa Biosystems, KK5517) and Lbx1 primers (Table S1) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The levels of relevant mRNAs were quantitated by real-time PCR using One Step SYBR GREEN RT-PCR Kit (Roche) in a Light Cycler instrument (Roche Applied Science ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Chromo-1 transcriptome sequencing was performed on the Illumina HiSeq platform (UCLA Clinical Microarray Core) with read lengths of 100 bp using the KAPA stranded RNA-seq kit (Roche) to construct paired-end libraries ...
-
bioRxiv - Neuroscience 2020Quote: ... 1ug of RNA per sample was processed using KAPA Stranded mRNA-Seq Kit with mRNA Capture Beads (Kapa Biosystems; KK8421). Library was eluted in 20µl of elution buffer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The Illumina library construction and sequencing were performed at Duke University using KAPA Hyper Prep kits (Kapa Biosystems, Wilmington, MA) and the Illumina NovaSeq 6000 platform (paired-end 150 bp reads) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Automated dual indexed libraries were constructed with 250 ng of genomic DNA utilizing the KAPA HTP Library Kit (KAPA Biosystems) on the SciClone NGS instrument (Perkin Elmer ...
-
bioRxiv - Developmental Biology 2020Quote: ... gbx1 and pax6a digoxigenin and FITC antisense probes were generated from linearized plasmids using an RNA labelling and detection kit (Roche)87 ...
-
bioRxiv - Microbiology 2021Quote: ... 1 µg of total RNA was then reverse-transcribed to cDNA using the iScript cDNA synthesis kit (Biorad; #1708891) (Roche). Diluted cDNAs (1:5 ...
-
bioRxiv - Pathology 2022Quote: ... We used genomic DNA isolated from ear tissue with a High Pure PCR Template Preparation Kit (Roche Diagnostics, Basel, Switzerland). The transgene was detected using RT2 qPCR Primer Assays from Qiagen (Venlo ...
-
bioRxiv - Neuroscience 2022Quote: ... A total of 72 mRNA libraries for Illumina sequencing were prepared using KAPA mRNA HyperPrep Kit (KAPA Biosystems, cat. KK8581) from 250 ng of total RNA ...
-
bioRxiv - Neuroscience 2021Quote: ... and then washed in PBS buffer before incubation with terminal deoxynucleotide transferase (In Situ Cell Death Detection kit; Roche, Switzerland) for 1 h at 37 °C in a solution containing TMR red dUTP ...
-
bioRxiv - Molecular Biology 2020Quote: ... Genomic DNA was sent to the Hopkins Genetics Resource Core Facility and High Throughput Sequencing Center and libraries were prepared using a KAPA HyperPlus Kit (Roche), and sequenced using Illumina NovaSeq 2X50 paired end reads.
-
bioRxiv - Molecular Biology 2020Quote: ... Sequencing libraries were constructed from 1 ng of immunoprecipitated and input DNA using the KAPA Hyper Prep kit (KAPA Biosystems) and NEXTflex ChIP-seq barcodes (Bio Scientific).
-
bioRxiv - Molecular Biology 2021Quote: ... and detection were performed with a DIG High Prime DNA Labeling and Detection Starter Kit (Roche Applied Science, Penzberg, Germany).
-
bioRxiv - Molecular Biology 2021Quote: ... lysed with immuno-precipitation (IP)-lysis buffer (from IP Lysis kit Pierce) and supplemented with anti-protease (Roche, Basel, Switzerland). Co-immuno-precipitation (Co-IP ...
-
bioRxiv - Molecular Biology 2020Quote: ... and detection were performed with a DIG High Prime DNA Labeling and Detection Starter Kit (Roche Applied Science, Penzberg, Germany). Total RNA was isolated from frozen fungal mycelia using an RNA extraction kit (Megan ...
-
bioRxiv - Molecular Biology 2021Quote: ... the SARS-CoV-2 containing cell culture supernatant was mixed (1:1 ratio) with the Lysis Binding Buffer from the Magnapure LC Kit # 03038505001 (Roche) to inactivate the virus ...
-
bioRxiv - Genomics 2022Quote: ... The libraries were quality controlled on an Agilent 2100 Bioanalyzer with the DNA 7500 assay for size and the concentration was estimated using quantitative PCR with the KAPA Library Quantification Kit Illumina Platforms (Roche).
-
bioRxiv - Genomics 2022Quote: Short-insert paired-end libraries of the lrPCR mtDNA product of the cell lines were prepared with KAPA HyperPrep kit (Roche) with some modifications ...
-
bioRxiv - Developmental Biology 2022Quote: ... samples were incubated with 27 µl labeling solution plus 3 µl enzyme solution (In Situ Cell Death Detection Kit, AP, Roche) at 37°C overnight ...
-
bioRxiv - Evolutionary Biology 2022Quote: We prepared libraries for each individual using the Kapa Hyper Prep library preparation kit (Kapa Biosystems Inc., Wilmington, MA, USA) and enzymatic fragmentation of DNA ...