Labshake search
Citations for Roche :
4051 - 4100 of 5469 citations for Rat BMP7 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
An optimized ChIP-Seq framework for profiling of histone modifications in Chromochloris zofingiensisbioRxiv - Genomics 2021Quote: RNA was converted into cDNA and made into sequence ready libraries with the KAPA RNA-Seq Kit (Kapa Biosystems). RNA-Seq libraries were sequenced with 150 bp single-end reads on a HiSeq 2500 ...
-
bioRxiv - Cell Biology 2020Quote: RACE-cDNA was synthesized according to the manufacturer’s protocol for 5’/3’ RACE Kit 2nd generation (Roche; Cat.No. 03353621001). The 2648-bp cDNA was cloned into the NheI-XhoI site in pcDNA 3.1 plasmid to obtain pcDNA3.1-DR5-AS and was verified by sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR analyses confirmed mouse genotypes with DNA isolated from ear biopsies using the KAPA Mouse Genotyping Kits (Kapa Biosystems). All PCR primers are listed in Supplementary Table 1.
-
bioRxiv - Developmental Biology 2022Quote: ... The library was enriched using 14 PCR cycles and quantified with Kapa NGS library quantification kit (Kapa Biosystems, KK4824) before pooling at a concentration of 20nM ...
-
bioRxiv - Cancer Biology 2022Quote: ... Post-capture amplification was performed using the KAPA HiFi Hot Start PCR ReadyMix Kit (KAPA Biosystems, Catalogue no. KK2601). Post-capture amplified libraries were quality controlled and quantified using a Tapestation 2200 with the High Sensitivity reagents.
-
bioRxiv - Molecular Biology 2022Quote: Southern blot analysis was performed using the DIG High Prime DNA Labeling and Detection Starter Kit II (Roche 11585614910) and the DIG Wash and Block Buffer Set (Roche 11585762001) ...
-
Activation of the Integrated Stress Response overcomes multidrug resistance in FBXW7-deficient cellsbioRxiv - Cancer Biology 2022Quote: ... The U6-sgRNA cassette was then amplified by PCR using the KAPA HIFI Hot Start PCR kit (Roche, KK2502) and different tagged primers required for the subsequent Illumina sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... Library quality control and quantification were performed using a KAPA Library Quantification Kit for Illumina Platforms (Kapa Biosystems, KK4873) and the 2100 Bioanalyzer equipped with a High Sensitivity DNA kit (Agilent ...
-
bioRxiv - Genetics 2022Quote: ... Library preparation was performed with 1ug of sheared DNA using Kapa Biosystems Hyper Prep Kit (Roche, product number KK8504) dual index adapters (KAPA ...
-
bioRxiv - Cancer Biology 2022Quote: 300 ng of total RNA was used for library preparation using the KAPA RNA HyperPrep kit with RiboErase (Roche), according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: Pax6a digoxigenin (DIG) antisense RNA probes were generated from linearised plasmids using an RNA labelling and detection kit (Roche) (Scholpp and Brand ...
-
bioRxiv - Systems Biology 2022Quote: ... libraries for polyA+ RNA were prepared using KAPA Stranded RNA-Seq Kit for Illumina Platforms (KAPA Biosystems, Wilmington, MA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and RNA sequencing libraries were prepared using 400 ng of total RNA using the Kapa mRNA Hyperprep kit (Roche) at 1/3rd reaction volume using 14 cycles of PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were also stained for β-galactosidase (β-gal) activity with the use of a staining kit (11828673001, Roche). Apoptotic cells were detected by TUNEL analysis with digoxigenin-labelled dUTP (S7105 ...
-
bioRxiv - Plant Biology 2021Quote: ... The qPCR was run using KAPA SYBR® FAST qPCR Kit Master Mix on LightCycler® 96 instrument (Roche) as described previously described (Han et al. ...
-
bioRxiv - Microbiology 2021Quote: ... The RNA-seq library was prepared from viral RNA extracts using the KAPA RNA HyperPrep Kit (Roche, Penzberg, Germany) and KAPA DI adaptors according to the manufacturers’ instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... DIG-labeled probes where generated using T7/SP6 transcriptions start sites and the digoxigenin RNA Labeling Mix kit (Roche) after manufactures instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... The TUNEL reaction was performed in a humid chamber for 2.5 h at 37 °C with the in Situ Cell Death Detection Kit (Roche) using 100 μL of reaction mixture per slide ...
-
bioRxiv - Cell Biology 2020Quote: ... and the concentration of indexed libraries was quantified following the protocol of the KAPA library quantification kit (Kapa Biosystems). For each donor libraries from all tissues were combined prior to sequencing and sequenced on the Illumina Hiseq 4000 system in 2 lanes.
-
bioRxiv - Neuroscience 2021Quote: ... Expressed sequence tags (ChESTs; SourceBioScience) were used to generate in situ probes using a DIG RNA labeling kit (Roche). In situ hybridization was performed as described (Mauti et al. ...
-
bioRxiv - Microbiology 2021Quote: ... cytotoxicity was determined by lactate dehydrogenase measurements on cell-free supernatants using the Cytotoxicity Detection Kit Plus assay (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... and PCR products were quantified fluorometrically using the KAPA SYBR FAST qPCR Master Mix (2X) Kit (KR0389, KAPA Biosystems).
-
bioRxiv - Microbiology 2022Quote: ... After 24 h treatments were performed and ATP was measured using the ATP Bioluminescence Assay Kit CLSII from Roche. This assay exploits the fact that luciferase requires ATP to produce light ...
-
bioRxiv - Microbiology 2022Quote: ... detection of bound conjugate was achieved by the use of an enhanced chemiluminescence assay (ECL) kit (Roche Applied Science). Images were acquired using a BIO-RAD ChemiDoc imaging system.
-
bioRxiv - Genetics 2022Quote: ... Total Ty1-copia sequences labeled with DIG were prepared as probes using the PCR-DIG Probe Synthesis Kit (Roche). ImageJ and Calculator software (http://cels.uri.edu/gsc/cndna.html ...
-
bioRxiv - Developmental Biology 2022Quote: Apoptosis in the migrating primordium was identified using terminal transferase-mediated dUTP nick end-labeling (TUNEL) assay according to manufacturer’s instruction with minor modifications (In situ Cell Death Detection Kit, TMR Red, Roche). Embryos at 30-42 hpf were dechorionated and fixed in 4% PFA overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... sequencing libraries were prepared by using a modified version of the KAPA HyperPrep library kit (KAPA Biosystems, Willmington, MA) and sequenced by a NovaSeq instrument ...
-
bioRxiv - Pathology 2022Quote: The supernatant from cultured NRVMs was collected to determine the content of LDH via cytotoxicity detection kit (Roche, USA), following the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2022Quote: ... The prepared libraries were then quantified by qPCR using the Kapa SYBR Fast Illumina Library Quantification Kit (Kapa Biosystems) and run on a Roche LightCycler 480 real-time PCR instrument ...
-
bioRxiv - Bioengineering 2022Quote: ... The libraries were pooled to 10 nM and diluted for qPCR using the KAPA Library Quantification Kit (Kapa Biosystems). Subsequently the pooled libraries were normalized to 4 nM based on qPCR values ...
-
bioRxiv - Developmental Biology 2019Quote: Digoxigenin (DIG)-labelled probes for in situ hybridization was synthesized by PCR using DIG RNA labelling kit (Roche #11175025910). The probes for Ssadh and CG33791 (αKDH ...
-
bioRxiv - Genomics 2019Quote: ... Libraries were prepared from total RNA following rRNA depletion with KAPA RNA HyperPrep Kit RiboErase according to manufacturer’s instructions (Roche). Illumina NovaSeq 50 bp paired-end sequencing was performed to obtain 50 million raw reads per library.
-
bioRxiv - Microbiology 2019Quote: ... RNA was manually extracted from fluid samples (CSF or blood serum) using the High Pure Viral RNA Kit (Roche). RNA was then subjected to reverse transcription and quantitative PCR using primers and a fluorescently conjugated probe on an Applied Biosystems 7900 instrument.
-
bioRxiv - Genetics 2019Quote: ... Gene expression was detected by RT-PCR using gene specific primers, (FW:AAAGCAGAACTGTTTGGCGG, RV:TTGGGACTGATGGACAAGGC) and a SYBR green nucleic acid-labeling SYBR FAST kit (Kapa Biosystems) in a Lightcycler 480 (Roche) ...
-
bioRxiv - Plant Biology 2020Quote: ... qRT-PCR reaction was prepared using a LightCycler® 480 SYBR Green I Master kit (Roche Diagnostics, Mannheim, Germany) and the PCR was performed with a LightCycler® 480 Instrument II (384-well ...
-
bioRxiv - Molecular Biology 2019Quote: ... Diluted extracts were amplified in 12 parallel reactions using the Transcriptor One-step RT-PCR kit (Roche, Basel, Switzerland) for reverse-transcription and first-round PCR ...
-
bioRxiv - Cancer Biology 2019Quote: Quantification of libraries was performed by quantitative polymerase chain reaction (qPCR) using the KAPA Library Quantification kit (KAPA Biosystems). Library fragment size was determined by the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2019Quote: ... The barcoded sequencing libraries were quantified by quantitative PCR using the KAPA Library Quantification Kit (KAPA Biosystems, Wilmington, MA). Sequencing libraries were sequenced using Novaseq 6000 (Illumina ...
-
bioRxiv - Cell Biology 2019Quote: ... The concentration of indexed libraries was quantified by RT–qPCR using the Universal Kapa Library Quantification Kit (KAPA Biosystems). Final libraries were normalized and sequenced on an Illumina HiSeq 2000 sequencer.
-
bioRxiv - Cancer Biology 2019Quote: ... DNA sequencing libraries were prepared for tumor and matched-normal DNA using the KAPA Hyper prep kit (Roche, USA); tumor RNA-Seq libraries were prepared using KAPA Stranded RNA-Seq with RiboErase kit ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Washing and detection steps were carried out as outlined in the manufacturer’s protocol for the DIG High Prime DNA Labeling and Detection Starter Kit II (Roche).
-
bioRxiv - Neuroscience 2020Quote: TUNEL assay (90) was performed using an in situ cell death detection kit conjugated with fluorescein isothiocyanate (Roche, 11684795910). DAPI (Vectashield Antifade Mounting Medium with DAPI ...
-
bioRxiv - Genomics 2020Quote: ... was generated with KAPA Hyperprep Stranded mRNA-seq library kits (Roche Sequencing and Life Science, Kapa Biosystems, Wilmington, MA) and sequenced with a Novaseq 6000 using 150bp paired end reads.
-
bioRxiv - Plant Biology 2020Quote: ... A 1 µg RNA was used to synthesize cDNA using a first-stand cDNA synthesis kit (Roche Diagnostics, Switzerland). The cDNA was normalized to 100 ng µl−1 and used for PCR analysis in a 10 µl reaction with gene-specific primers (5‘-CGTGGGATACCCTTACATGG and 5‘-CCCGATTATCTTCCACCAGA for ZmOMT1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... up to 5 ng/sample of ChIP was prepared for sequencing using the Kapa Hyper-prep Kit (Kapa Biosystems) using NEXTflex adapters (Bio Scientific) ...
-
bioRxiv - Genomics 2019Quote: ... Cells were then harvested and genomic DNA was extracted with a High Pure PCR Template Preparation Kit (Roche 11796828001). MinION runs were performed on R9 with 400-500ng purified DNA per sample following library preparation with Ligation Sequencing Kit 1D (ONT SQK-LSK108) ...
-
bioRxiv - Immunology 2020Quote: ... genes of SARS-CoV-2 was performed using the LightMix Modular SARS and Wuhan CoV E-gene Kit (TIB MOBIOL, Synheselabor GmbH, Berlin, Germany) in a LightCycler 480 II system following the manufacturer’s recommendation (Roche Diagnostics International Ltd. ...
-
bioRxiv - Cell Biology 2020Quote: ... Apoptotic cells were detected in dissected guts using the TMR red In Situ Cell Death Detection Kit (Roche; 12156792910) following standard kit staining protocol ...
-
bioRxiv - Genomics 2020Quote: ... Bisulfite converted DNA was then used as template for PCR amplification with KAPA HiFi HotStart Uracil kit (Roche, KK2801) using primers surrounding Site 1 in intron 8 of the Fto gene ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The pooled and purified library was quantified using the Universal KAPA Library Quantification kit for Illumina platforms (Roche, # KK4824). The pooled TempO-Seq® library was sequenced in-house using the NextSeq® 500/550 High Output Kits v2 (75 cycles ...