Labshake search
Citations for Roche :
4201 - 4250 of 5370 citations for QuantiFluo Ammonia Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... pre-capture libraries were prepared from up to 100 ng of input DNA using the KAPA Hyperplus kit (Roche) and TruSeq adapters and barcoded primers (Illumina) ...
-
bioRxiv - Evolutionary Biology 2024Quote: A PCR free library was prepared following the Kapa Hyper Prep Kit procedure provided by Roche (Roche, Basel, Switzerland). The library was sequenced on a paired-end mode with an Illumina NovaSeq 6000 instrument (Illumina ...
-
bioRxiv - Plant Biology 2020Quote: ... The first-strand cDNA was synthesized from 2 μg of total RNA with an anchored-oligo (dT)18 primer using the Transcriptor High Fidelity cDNA Synthesis Kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... and the powder was solubilized in the native extraction buffer supplied in the kit with addition of Complete Protease Inhibitor Cocktail (Roche). After incubation on ice for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... Southern blotting was carried out using Hybond-N+ membrane (Amersham) and DIG High Prime DNA Labeling and Detection Starter kit II (Roche), following the indications of the manufacturer ...
-
bioRxiv - Cancer Biology 2021Quote: ... Reverse transcription was done with the first Strand synthesis kit (Fermentas) using oligo (dT)18 as a primer and qPCR was carried out with LightCycler 96 (Roche) using GAPDH.
-
bioRxiv - Cancer Biology 2021Quote: ... MCF-7 shRNA and MCF-7 shFTH1 as well as H460 shRNA and H460 shFTH1 using the High Pure RNA isolation kit (Roche) according to the manufacturer’ ss instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... was used as the template to create the Scx mRNA probe by utilizing the DIG RNA Labeling Kit Catalog #11175025910 (Roche) and the T3 RNA polymerase Catalog #11031163001 (Roche) ...
-
bioRxiv - Cell Biology 2020Quote: ... Target regions were amplified by using specific PCR primers (ETV2_F: CACTCGGGATCCGTTACTCC; ETV2_R: GTTCGGAGCAAACGGTGAGA, KDR_F: CAAGCCCTTTGTTGTACTCAATTCT; KDR_R: ATTAATTTTTCAGGGGACAGAGGGA) and KAPA HiFi HotStart PCR kit (KAPA Biosystems, Cat No. KK2601). Sanger sequencing (Genewiz ...
-
bioRxiv - Cell Biology 2020Quote: The RNA probes were transcribed with the T7 polymerase and labeled using the DIG RNA labeling kit (Roche Cat # 11175025910). After the labeling reaction was complete ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell viability was assessed by addition of 5 μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (i.e., MTT) using a Cell Proliferation Kit I (Roche Diagnostics, Mannheim, Germany), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... were performed with the Ventana Bench-Mark XT automated staining system (Ventana) using the UltraView Universal DAB Detection Kit (Roche). For α-Syn ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA probes were created from in vitro transcription of PCR products carrying the T7 RNA polymerase recognition sequence at one end and synthesized by using a digoxigenin (Dig)-labeling kit (Roche). Wing discs of L3 larvae were hybridized with probes overnight at 56 °C using standard procedures and visualized using anti-Dig-AP (1:1,000 ...
-
bioRxiv - Microbiology 2020Quote: ... Both the pET28a vector and the Rv1630 gene amplification product (1446 bp) were purified using the PCR quick spin kit (Roche) following the manufacturer’s protocol ...
-
X-linked palindromic gene families 4930567H17Rik and Mageb5 are dispensable for male mouse fertilitybioRxiv - Genetics 2021Quote: ... Final libraries were quantitated by Kapa qPCR using Kapa’s library quantification kit for Illumina sequencing platforms (Kapa Biosystems, catalog # KK4835). Pooled libraries were subjected to 150 bp paired-end sequencing according to the manufacturer’s protocol (Illumina NovaSeq6000 ...
-
bioRxiv - Genetics 2021Quote: ... For whole-genome sequencing DNA was extracted using the MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche Diagnostics GmbH).
-
bioRxiv - Developmental Biology 2021Quote: ... Digxigenin (DIG)-labeled sense and antisense probes were performed from the linearized pGEM-T-easy plasmids using the DIG RNA Labeling Kit (Roche).
-
bioRxiv - Microbiology 2020Quote: ... and via real-time quantitative polymerase chain reaction (qPCR) with the KAPA Library Quantification Kit (Kapa Biosystems, Wilmington, MA, USA). Final library pools were spiked with a non-indexed PhiX control library (Illumina ...
-
bioRxiv - Microbiology 2019Quote: ... To determine the viral load by RT-qPCR RNA was extracted from apical washes (High Pure Viral RNA kit, Roche). cDNA was prepared using 10 µL RNA (High Capacity cDNA Reverse Transcription kit ...
-
bioRxiv - Developmental Biology 2021Quote: Mice ear notches or embryo tail tips were genotyped by PCR using Kapa2G Robust HotStart PCR Kit (Kapa Biosystems, KK5517) and Lbx1 primers (Table S1) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The levels of relevant mRNAs were quantitated by real-time PCR using One Step SYBR GREEN RT-PCR Kit (Roche) in a Light Cycler instrument (Roche Applied Science ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Chromo-1 transcriptome sequencing was performed on the Illumina HiSeq platform (UCLA Clinical Microarray Core) with read lengths of 100 bp using the KAPA stranded RNA-seq kit (Roche) to construct paired-end libraries ...
-
bioRxiv - Neuroscience 2020Quote: ... 1ug of RNA per sample was processed using KAPA Stranded mRNA-Seq Kit with mRNA Capture Beads (Kapa Biosystems; KK8421). Library was eluted in 20µl of elution buffer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The Illumina library construction and sequencing were performed at Duke University using KAPA Hyper Prep kits (Kapa Biosystems, Wilmington, MA) and the Illumina NovaSeq 6000 platform (paired-end 150 bp reads) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Automated dual indexed libraries were constructed with 250 ng of genomic DNA utilizing the KAPA HTP Library Kit (KAPA Biosystems) on the SciClone NGS instrument (Perkin Elmer ...
-
bioRxiv - Developmental Biology 2020Quote: ... gbx1 and pax6a digoxigenin and FITC antisense probes were generated from linearized plasmids using an RNA labelling and detection kit (Roche)87 ...
-
bioRxiv - Microbiology 2021Quote: ... 1 µg of total RNA was then reverse-transcribed to cDNA using the iScript cDNA synthesis kit (Biorad; #1708891) (Roche). Diluted cDNAs (1:5 ...
-
bioRxiv - Pathology 2022Quote: ... We used genomic DNA isolated from ear tissue with a High Pure PCR Template Preparation Kit (Roche Diagnostics, Basel, Switzerland). The transgene was detected using RT2 qPCR Primer Assays from Qiagen (Venlo ...
-
bioRxiv - Neuroscience 2022Quote: ... A total of 72 mRNA libraries for Illumina sequencing were prepared using KAPA mRNA HyperPrep Kit (KAPA Biosystems, cat. KK8581) from 250 ng of total RNA ...
-
bioRxiv - Neuroscience 2021Quote: ... and then washed in PBS buffer before incubation with terminal deoxynucleotide transferase (In Situ Cell Death Detection kit; Roche, Switzerland) for 1 h at 37 °C in a solution containing TMR red dUTP ...
-
bioRxiv - Molecular Biology 2020Quote: ... Genomic DNA was sent to the Hopkins Genetics Resource Core Facility and High Throughput Sequencing Center and libraries were prepared using a KAPA HyperPlus Kit (Roche), and sequenced using Illumina NovaSeq 2X50 paired end reads.
-
bioRxiv - Molecular Biology 2020Quote: ... Sequencing libraries were constructed from 1 ng of immunoprecipitated and input DNA using the KAPA Hyper Prep kit (KAPA Biosystems) and NEXTflex ChIP-seq barcodes (Bio Scientific).
-
bioRxiv - Molecular Biology 2021Quote: ... and detection were performed with a DIG High Prime DNA Labeling and Detection Starter Kit (Roche Applied Science, Penzberg, Germany).
-
bioRxiv - Molecular Biology 2021Quote: ... lysed with immuno-precipitation (IP)-lysis buffer (from IP Lysis kit Pierce) and supplemented with anti-protease (Roche, Basel, Switzerland). Co-immuno-precipitation (Co-IP ...
-
bioRxiv - Molecular Biology 2020Quote: ... and detection were performed with a DIG High Prime DNA Labeling and Detection Starter Kit (Roche Applied Science, Penzberg, Germany). Total RNA was isolated from frozen fungal mycelia using an RNA extraction kit (Megan ...
-
bioRxiv - Molecular Biology 2021Quote: ... the SARS-CoV-2 containing cell culture supernatant was mixed (1:1 ratio) with the Lysis Binding Buffer from the Magnapure LC Kit # 03038505001 (Roche) to inactivate the virus ...
-
bioRxiv - Genomics 2022Quote: Short-insert paired-end libraries of the lrPCR mtDNA product of the cell lines were prepared with KAPA HyperPrep kit (Roche) with some modifications ...
-
bioRxiv - Developmental Biology 2022Quote: ... samples were incubated with 27 µl labeling solution plus 3 µl enzyme solution (In Situ Cell Death Detection Kit, AP, Roche) at 37°C overnight ...
-
bioRxiv - Evolutionary Biology 2022Quote: We prepared libraries for each individual using the Kapa Hyper Prep library preparation kit (Kapa Biosystems Inc., Wilmington, MA, USA) and enzymatic fragmentation of DNA ...
-
bioRxiv - Genomics 2020Quote: ... RNA-seq libraries were generated using 300 ng of RNA with the Kapa Hyper total stranded RNA library kit for Illumina (Roche) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Entire material of one conversion was equally distributed to a 96-well plate and amplified via PCR using KAPA HiFi Uracil+ Kit (Roche) in a total volume of 16µl ...
-
bioRxiv - Genomics 2020Quote: ... The optimal numbers of PCR cycles for individual libraries were determined with a Real-Time Library Amplification Kit (KAPA Biosystems) by preliminary qPCR-based quantification using an aliquot of adaptor-ligated DNAs as described previously24 ...
-
bioRxiv - Genomics 2020Quote: ... Samples were pooled (150 ng of each reference samples and 100 ng of other samples) and the final library concentration was determined by qPCR (KAPA Library Quantification Kit, Roche). Sequencing was performed on a NextSeq 500 benchtop sequencer (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... Illumina-compatible sequencing libraries were prepared by using a modified version of KAPA HyperPrep library kit (KAPA BioSystems, Willmington, MA). Quality check steps were performed to assess the fraction of proximally ligated DNA labeled with biotin ...
-
bioRxiv - Genomics 2020Quote: ... mixed with alignment oligos and sample tracking control oligos (Nimblegen Hybridisation and Sample Tracking Control Kits) and hybridised to a 12×135k HD2 expression array (Roche Nimblegen ...
-
bioRxiv - Cancer Biology 2019Quote: RNA sense and anti-sense probes were synthesized from pcsDest2-gdf6a and pcsDest2-gdf6b constructs using DIG RNA Labeling Kit (Roche) per the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2019Quote: ... Antisense DIG-labelled eiger RNA probe was prepared from XhoI-linearized pBSK-eiger plasmid using T3 RNA polymerase (DIG RNA Labeling Kit, Roche) and detected with the DIG Nucleic Acid Detection Kit (Roche) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Probe labeling and Southern blot detection were carried out using ‘DIG High Prime DNA Labeling and Detection Starter Kit I’ (Roche). Probes were generated using PCR based amplification of the (TTAGGG ...
-
bioRxiv - Developmental Biology 2020Quote: ... Sense and antisense digoxigenin-labeled RNA probes were prepared from a BglII-digest of the pMPX2-1 mouse Pax6 cDNA clone (25) using a DIG RNA labeling kit (Roche). Hybridization and stringent posthybridization wash steps were performed at 65°C.
-
bioRxiv - Molecular Biology 2019Quote: Detection of DNA strand breaks in MC3935-treated schistosomula was performed using the In situ Cell Death Detection kit (Roche), as previously described (33) ...