Labshake search
Citations for Roche :
4151 - 4200 of 9754 citations for Monoisodecyl Phthalate 100 Ug Ml In Mtbe Unlabeled Mono 3 7 Dimethyl 1 Octyl Phthalate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Pre-capture libraries were prepared from up to 100 ng input DNA using the KAPA Hyperplus kit (Roche) and TruSeq adapters and barcoded primers (Illumina) ...
-
bioRxiv - Neuroscience 2022Quote: Brain sections were washed three times then permeabilized in TBS with 0.2% Triton-X 100 (TBST; Roche, Switzerland) at room temperature ...
-
bioRxiv - Developmental Biology 2024Quote: ... in Buffer D (20mM HEPES pH 7.9, 150mM KCl, 20% glycerol, 0.2mM EDTA, 0.2% Triton X-100 and 1x complete Roche inhibitor) overnight at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... in Buffer D (20 mM HEPES pH 7.9, 150 mM KCl, 20% glycerol, 0.2 mM EDTA, 0.2% Triton X-100 and complete Roche inhibitor) overnight at 4°C ...
-
bioRxiv - Plant Biology 2023Quote: ... and 0.1% [v/v] Triton X-100) with cOmplete EDTA-free Protease Inhibitor Cocktail (Roche, catalog no. 11873580001), 1 mM PMSF ...
-
bioRxiv - Cell Biology 2023Quote: DIV 12-14 cortical neurons were scraped from the plate in lysis buffer (PBS pH 7.5, 0.5% v/v Triton X-100 supplemented with protease inhibitors (EDTA-free Complete; Roche), kept on ice for 15 min and then centrifuged at 15,000 x g for 10 min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... A total of 100 ng RNA was subsequently reverse transcribed using the Transcriptor First Strand cDNASynthesis Kit (Roche) at 55 °C for cDNA synthesis ...
-
bioRxiv - Molecular Biology 2023Quote: ... and then lysed and harvested in ChIP lysis buffer (50 mM Tris-HCl pH 8.1; 0.5% SDS; 10 mm EDTA;100 mM NaCl, 1mM PMSF, Proteinase inhibitor Roche) by centrifugation for 6 min at 2,000 × g ...
-
bioRxiv - Genetics 2023Quote: ... 150 mM NaCl, 2.5 mM MgCl2, 250 mM sucrose, 0.05% NP40, 0.5% Triton X-100, 1x Roche-Complete). Samples were cleared by centrifugation at 10000 × g at 4°C for 10 min ...
-
bioRxiv - Immunology 2023Quote: ... 100 ng total RNA was reverse transcribed into cDNA using Transcriptor First Strand cDNA Synthesis Kit (Roche, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and lysed in lysis buffer (50mM Tris, pH 7.4, 500mM NaCl, 0.4% SDS, 2% Triton-X-100, 1mM DTT, 1x complete protease inhibitor [Roche]). Lysates were sonicated twice for 1 minute at 30% duty cycle at an output level of 4 ...
-
bioRxiv - Immunology 2023Quote: ... HEK293T cells were lysed in LUMIER lysis buffer (50 mM Hepes-KOH pH 7.9, 150 mM NaCl, 2 mM EDTA, 0.5% Triton X-100, 5% glycerol and Roche cOmplete™ Mini protease Inhibitor Cocktail ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 ng of DNA were used to prepare libraries using the KAPA Hyper Prep Kit (Kapa Biosystems KK8504) with 8 cycles of PCR ...
-
bioRxiv - Plant Biology 2023Quote: ... 50 grams of Arabidopsis leaves were homogenized for 1 min in 2 volumes of resuspension buffer (100 mM MES, pH 6.4, 3mM EDTA, 0.5 mM MgCl2, 1mM EGTA, protease inhibitors (Roche)) using a Waring Blender ...
-
bioRxiv - Cell Biology 2023Quote: ... and 100 / 30 ng (immunoprecipitation/input) used for library preparation using KAPA LTP library preparation kit (KAPA Biosystems). Library preparation was stopped prior to PCR amplification ...
-
bioRxiv - Developmental Biology 2023Quote: Dissected embryonic brain structures were lysed in RIPA buffer (Tris HCl 1M, pH 7.7; NaCl 5M; EDTA 0.5M; Triton X-100) supplemented with protease inhibitors (Roche) and phosphatase inhibitors (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were treated with 10 µM Olaparib-containing medium for the 48 h before being washed with PBS and pre-extracted with pre-extraction buffer (10 mM Tris-HCl, 2.5 mM MgCl2, 0.5% NP-40, 100× Protease inhibitor cocktail (Roche)) for 5 min at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... pH 7.9; 5 mM MgCl2; 0.2% Triton X-100; 20% glycerol; 300 mM NaCl and freshly added ROCHE cOmplete protease inhibitor cocktail at 0.01 tablet/mL) ...
-
bioRxiv - Pathology 2023Quote: ... 100 ng pCMV4-BlaM-Vpr and 60 ng pAdVAntage ™ Vector using X-treme gene transfection reagent (Roche). Supernatant was harvested at 48 and 72 h post-transfection ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were thawed on ice and disrupted in lysis buffer (100 mM Tris-HCl pH 7.4, 0.5% Triton X-100, 150 mM NaCl, 13% w/v glycerol, protease inhibitor tablet, Roche) by bead beating (mini bead beater-16 ...
-
bioRxiv - Biochemistry 2024Quote: ... cremoris samples were resuspended in 100 mM Tris-HCl (pH 8.5) with a protease inhibitor cocktail tablet (Roche) and 2% sodium dodecyl sulfate ...
-
bioRxiv - Neuroscience 2024Quote: ... cells from one 10 cm dish were lysed with 400 µl lysis buffer (50 mM HEPES pH 7.4, 300 mM NaCl, 0.5 % Triton X-100, complete protease inhibitor cocktail [Roche]). The lysate was centrifuged at 13.000 x g for 15 min and the supernatant (SN ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Blocking was performed in MAB blocking buffer (100 mM Maleic acid, 150 mM NaCl, 2% Blocking reagent [Roche, 1096176] ...
-
bioRxiv - Physiology 2024Quote: ... 5 mM EDTA, 2% Triton-X-100, 0.2 mM HDSF, pH 7.4, and protease inhibitor cocktail from Roche). Following sonication on ice ...
-
bioRxiv - Microbiology 2024Quote: ... and incubated overnight with primary antibody (monoclonal anti-FLAG, 1:10,000, Sigma #F1804-5MG; anti-GroEL, 1:10,000, Sigma; or anti-GFP, 1:10,000, Roche #11814460001 in 3% bovine serum albumin (BSA)/TBS-T ...
-
bioRxiv - Neuroscience 2020Quote: ... 1% NP-40 and 1× protease inhibitor cocktail (cOmplete, Roche), phosphatase inhibitor cocktails I and II (Millipore) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM EDTA and 1% CompleteTM protease inhibitor cocktail (Roche)) by passing the cell mixture through a 26-gauge needle at 4°C (50-100 strokes) ...
-
bioRxiv - Genomics 2020Quote: ... 1 protease inhibitor tablet (Roche Complete cat #1 697 498) per 50ml buffer) ...
-
bioRxiv - Plant Biology 2019Quote: ... blocked in 1×TBS-T with 1% Blocking Reagent (Roche) at room temperature for 1 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1% NP-40 and 1× complete protease inhibitor cocktail (Roche)) by three rounds of chopping the tissue using dissection scissors and a handheld homogenizer7 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% SDS solution after adding protease inhibitor (Roche 4693116001; 1×) and phosphatase inhibitor cocktails (Roche 4906845001 ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% BSA (Roche), 20% Dextran Sulfate (Sigma ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 × PhosSTOP (Roche)] and incubated on ice for 20 min ...
-
bioRxiv - Cell Biology 2019Quote: ... 1× PhosSTOP (Roche)) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1× cOmplete (Roche), and lysed by bead-beating ...
-
bioRxiv - Biochemistry 2020Quote: ... 1% NP40 (Roche) and a phosphatase inhibitor mixture containing 20 mM NaF ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 × PhosSTOP (Roche)] and incubated on ice for 20 min ...
-
bioRxiv - Plant Biology 2023Quote: ... 1/1000 (Roche); HRP-conjugated anti-FLAG antibody ...
-
bioRxiv - Developmental Biology 2023Quote: ... PhosSTOP 1% (Roche)) and mechanically with a pellet pestle ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Developmental Biology 2020Quote: ... Enrichment of 2 μg of an indexed library incubated with 3 μM of a pool of biotinylated oligonucleotides was performed using the SeqCap EZ Hybridization reagent kit (Roche/NimbleGen, Lot # 05634261001), following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-bromo-4-chloro-3-indolylphosphate (BCIP) and nitroblue tetrazolium chloride (NBT) according to the manufacturer’s protocol (Roche Applied Science, Indianapolis, IN, USA). The sections were then mounted ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 16-20h incubation at room temperature and colorimetric signals were detected using Nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphase (NBT-BCIP; Roche Applied Sciences 11383221001). RNAScope ISH was conducted for FGF15 and Ptch1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 80 µl of dephosphorylation solution (8 μl 10x dephosphorylation buffer, 2 μl RNasin Plus, 67 μl ddH2O, and 3 μl alkaline phosphatase (Roche, catalog no. 10713023001)) was added to the beads ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antimouse secondary antibodies conjugated with alkaline phosphatase was used to detect color signal formed by BCIP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium) substrates (Roche Biochemical, Mannheim, Germany).
-
bioRxiv - Neuroscience 2022Quote: ... 20 mg protein was loaded onto 8-10% SDS-PAGE gels for electrophoresis and subsequently transferred (90 V, 2-3 h) onto PVDF western blotting membranes (Roche, Cat. No. 3010040001) using the Criterion™ System BioRad ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Cell Biology 2021Quote: ... mitotic cells were obtained by mitotic shake-off and swelled in hypotonic buffer (75 mM KCl:0.8% NaCitrate:H2O at 1:1:1) with protease inhibitor cocktail (Roche) at room temperature for 10-15 min ...
-
bioRxiv - Microbiology 2020Quote: Whole cell lysates were generated by lysing cells in RIPA buffer (50 mM Tris-Cl [pH 7.4], 150 mM NaCl, 1% NP-40, 0.25% sodium deoxycholate, 1 mM phenylmethylsulfonyl fluoride [PMSF], 1× Roche complete mini-protease inhibitor cocktail ...
-
bioRxiv - Microbiology 2023Quote: ... pH 6.8, 10 mM DTT, 1 mM EDTA, 0.1% Tween, 1 mM PMSF, 1× Mini Protease Inhibitor Cocktail, Roche). The samples were centrifuged at 3000g for 6 min at 4°C using a tabletop centrifuge ...