Labshake search
Citations for Roche :
3901 - 3950 of 4072 citations for 4F2 Cell Surface Antigen Light Chain SLC7A5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... Cells were lysed (10mM Tris-HCl [pH 8], 0.25% Triton X-100, 10mM EDTA, 100mM NaCl, Roche 1X Complete Protease Inhibitor) and nuclei were collected and re-suspended in 300μl SDS lysis buffer (1% SDS ...
-
bioRxiv - Developmental Biology 2020Quote: A 257 bp digoxigenin-labeled RNA probe was generated from a region spanning exons 1-3 of cat Dkk4 using a PCR-based template (cDNA from Stage 16 cat embryonic epidermal cells; CCCTGAGTGTTCTGGTTTT, AATATTGGGGTTGCATCTTCC) and in vitro transcription (Roche Diagnostics). 10 μ M paraffin-embedded sections were deparaffinized with xylenes and antigen retrieval using 0.01 M citrate buffer ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... The reagents were added in the dark according to the instructions of the In Situ Cell Death Detection Kit (Roche, US). Images were acquired under a fluorescence microscope.
-
bioRxiv - Neuroscience 2020Quote: ... After centrifugation, cells were lysed (750 mM NaCl, 10 mM Tris, 1 mM EDTA pH 7.6, protease inhibitor (Roche, Mannheim, Germany)) ...
-
bioRxiv - Cell Biology 2019Quote: Cells were lysed in Tris-buffered saline (TBS) supplemented with 1% Triton X-100 and protease/phosphatase inhibitor cocktails (Roche Diagnostics), the insoluble material was cleared by centrifugation for 10 min at 20,000 × g ...
-
bioRxiv - Genomics 2019Quote: ... after cells were lysed with Farnham Lysis Buffer (5 mM HEPES pH 8.0, 85 mM KCl, 0.5% IGEPAL, Roche Protease Inhibitor Cocktail), and nuclei were resuspended in RIPA buffer (1x PBS ...
-
bioRxiv - Genetics 2021Quote: ... and the internal control vector TK (25 ng per well for 48-well plate) were co-transfected into the cells by using the X-tremeGene HP DNA transfection reagent (ROCHE, 6366236001). The transfected HEK293T cells were harvested in 65 μL passive lysis buffer (Promega ...
-
bioRxiv - Genetics 2020Quote: ... 100,000 cells were washed twice (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 1x Roche cOmplete protease inhibitors) and attached to 10 ConA-coated magnetic beads (Bangs Laboratories ...
-
bioRxiv - Cancer Biology 2021Quote: The terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay was used for detecting cell apoptosis according to the manufacturer’s instructions (Roche Diagnostics, USA). In brief ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were harvested and resuspended in purification buffer (supplemented with Complete Protease Inhibitor Cocktail tablet as per Roche Applied Science instructions), and lysed by sonication ...
-
bioRxiv - Cell Biology 2020Quote: ... Fusion was carried out by resuspending the mixed cell pellet slowly in 1 mL of 50% PEG 1500 (Roche, Basel, Switzerland) at 37°C over the course of 1 minute and incubated for a further 1 minute at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... cell pellets were resuspended in a lysis buffer (see below) supplemented with 1x protease inhibitor cocktail (Roche cOmplete Protease Inhibitor Cocktail) and lysed using a Dounce homogenizer (20 strokes with loose plunger followed by 20 strokes tight plunger) ...
-
bioRxiv - Developmental Biology 2021Quote: Cos-1 cells were grown in DMEM supplemented with 10% heat inactivated FCS and transfected with Fugene HD (Roche Applied Science) according to manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... 3.75 μg of psPAX2 and 1.25 μg of pVSVG) were transfected into LentiX-293T cells using 20 μl of X-tremeGENE™ HP DNA Transfection Reagent (Roche) at 37°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mg of plasmid DNA was transfected into HMEC P5 was transduced into Phoenix packaging cells using Fugene (Roche, Basel, Switzerland). Viral supernatant was harvested 48 h after transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA expressing vectors along with retroviral packaging vectors Gag-Pol and VSG-G were transfected into HEK293T cells using X-tremeGENE 9 DNA Transfection reagent (Roche #6364787001). Virus-containing supernatant was collected 48 hours after transfected and passed through a 0.45μm filter ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNA expressing vectors along with lentiviral packaging vectors Delta-VPR and VSV-G were transfected into HEK293T cells using X-tremeGENE 9 DNA Transfection reagent (Roche #6364787001). cDNA expressing vectors along with retroviral packaging vectors Gag-Pol and VSG-G were transfected into HEK293T cells using X-tremeGENE 9 DNA Transfection reagent (Roche #6364787001) ...
-
bioRxiv - Biochemistry 2022Quote: ... coli cells were lysed by sonication on ice in PBS pH 7.4 with protease inhibitors (cOmplete, EDTA-free, Roche Applied Science). The protein was purified over Glutathione Sepharose 4 Fast Flow (GE Healthcare ...
-
bioRxiv - Bioengineering 2022Quote: ... the cells were rinsed with PBS and incubated with 5% (v/v) normal donkey serum and 1% (w/v) BSA (Roche, 10.7350.86001) in PBS for 1 hour at room temperature to block the non-specific antibody binding ...
-
bioRxiv - Bioengineering 2022Quote: ... Encapsulated or adherent cells were plated in a 96 well plate for 24 or 48h when WST-1 reagent (Roche, Switzerland) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... IFNγ-R2-eGFP plasmid was transfected in HeLa or Caco-2 cells with X-tremeGENE HP DNA transfection reagent (Roche, 6366236001) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... Tissues or cells were lysed in NP-40 lysis buffer (Beyotime P0013F) supplemented with protease inhibitor cocktail (complete Mini, Roche 04693124001), phosphatase inhibitor cocktail (PhosSTOP ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... cells were maintained in growing media (DMEM + Glutamax, 10% FBS, pen/strep 5ml) supplemented with 0.8mg/ml G418 (Roche, G418-RO) for maintenance or removed for exposure to chemicals ...
-
bioRxiv - Molecular Biology 2022Quote: ... and pellet cells were then resuspended in 400 μL of lysis buffer (PBS 1x supplemented with Roche protease inhibitor and benzonase). Cells were lysed by sonication (30% Amp ...
-
bioRxiv - Molecular Biology 2022Quote: ... The recombinant plasmid pcDNA3.1-Orm2 was transiently transfected into LO2 cells for 48 h with X-treme GENETMHP DNA Transfection Reagent (Roche, Basel, Switzerland).
-
bioRxiv - Microbiology 2022Quote: ... cell pellet was resuspended in prechilled buffer A (20 mM Tris/HCl, pH: 8) supplemented with cOmplete™ protease inhibitor (Roche) and 5 mM EDTA ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were then resuspended in 10 ml of cold PBS and incubated with cOmplete mini EDTA-free protease inhibitor (Roche, 11836170001) for 30 min at 4°C ...
-
bioRxiv - Bioengineering 2024Quote: ... the cells were harvested from the matrices by digesting the collagen with liberase DL research grade (24 U; Roche, Basel, Switzerland). The cells were then fixed with 4% PFA ...
-
bioRxiv - Bioengineering 2024Quote: ... the cells were harvested from the matrices by digesting the collagen with liberase DL research grade (24 U; Roche, Basel, Switzerland). The cells were then fixed with 4% PFA ...
-
bioRxiv - Cell Biology 2024Quote: ... assay was performed following our previous publication(4, 55) and the instruction of In Situ Cell Death Detection Kit TMR red (Roche, 12156792910). Cells were cultured on coverslips for 36 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... treated with λPPase or that purified from Calyculin A-treated cells was subjected to proteolytic digestion with 0.01 ng/µl trypsin (Roche, sequencing grade) for 0 ...
-
bioRxiv - Neuroscience 2024Quote: ... Tissues were washed three times with TBS-T and were incubated with a TUNEL reaction mixture (In Situ Cell Death Detection Kit, TMR red, Roche 12156792910) for 1 h at 37 °C ...
-
bioRxiv - Genomics 2023Quote: hTERT RPE-1 cells at 70% confluence were harvested by trypsinization after 2-hour treatment with colcemid (100 ng/ml, Roche 10295892001) to arrest cells in mitosis ...
-
bioRxiv - Immunology 2024Quote: Cells proteins were lysed and isolated from cell pellet by RIPA buffer (Thermo, 89901) with cOmplete mini EDTA free protease inhibitor (Roche, 11836170001) on ice incubation for 30 min and centrifugation at 15,000 rpm for 15 min at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... and a sgRNA preceded by a rrk1 leader and followed by a Hammerhead Ribozyme as described in [17] was digested and prepared for gap repair as follows: the vector pJB166 was purified from DH5α bacterial cells using the Genopure plasmid midi kit (Roche, 03143414001) and diluted to 1 μg/μL ...
-
bioRxiv - Cell Biology 2023Quote: The tissues from treated mice and HFs were used for TUNEL apoptotic detection (In Situ Cell Death Detection Kit, TMR Red, Roche 12156792910) After fixation and antigen retrieval procedures ...
-
bioRxiv - Immunology 2023Quote: ... Brain and spinal cord samples specifically processed for the detection of intracellular MBP within phagocytic cells were predigested with 0.5 mg/mL Collagenase/Dispase® (Roche, #11097113001), 0.02 mg/mL DNase I (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... the T cells were activated in X-VIVO 15 containing 150 U/mL of human IL-2 (#Ro 23-6019, Roche, Switzerland), 10 ng/mL of recombinant IL-7 (#200-07 ...
-
bioRxiv - Cancer Biology 2023Quote: The cellular metabolic viability was measured by NADH-dependent mitochondrial dehydrogenase activity using Cell Proliferation Kit II (XTT) (Roche, Basel, Switzerland) according to the manufacturer’s protocol by measuring the absorbance at 492nm in BioTek Synergy HTX multimode reader ...
-
bioRxiv - Cancer Biology 2023Quote: ... This plasmid was digested with PacI and transfected into HEK293 cells using X-tremeGENETM HP DNA transfection reagent (Roche, Basel, Switzerland) to produce infectious viral particles ...
-
bioRxiv - Immunology 2023Quote: ... Apoptosis also was detected using a terminal deoxynucleotidyl transferase (TdT)-mediated deoxyuridine triphosphate (dUTP)-biotin nick end-labeling (TUNEL) assay with Cell Death Detection Kit (Roche, Germany). Nuclei were stained with 4-6-diamidino-2-phenylindole (DAPI ...
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...
-
Ribosomal quality control factors inhibit repeat-associated non-AUG translation from GC-rich repeatsbioRxiv - Molecular Biology 2023Quote: ... each well of cells from 24-well plates was lysed with 120 μL of RIPA buffer with protease inhibitor (Roche, 11836153001). All protein lysates were denatured with 12% β-mercapto-ethanol in 6x SDS-loading dye ...
-
bioRxiv - Molecular Biology 2023Quote: ... 250-500k cells were washed twice (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 1× Roche cOmplete protease inhibitors) and attached to 10 uL ConA-coated magnetic beads (Bangs Laboratories ...
-
bioRxiv - Cell Biology 2023Quote: ... The cells were further incubated for 48 h and subsequently subjected to Gentamycin (G418) selection (1 μg/ml, Roche, G418-RO). After 4 days cells were sorted on a fluorescence-activated cell sorter (FACS ...
-
bioRxiv - Microbiology 2023Quote: ... 300 mM NaCl and 2 mM β -mercaptoethanol) per 5 × 108 cells in the presence of EDTA-free anti-protease cocktail (complete from Roche). Lysis was performed with two cycles of freezing (− 180 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... the cells were rinsed with PBS and incubated with 5% (v/v) normal donkey serum and 1% (w/v) BSA (Roche, 10.7350.86001) in PBS for 1 hour at room temperature to block the non-specific antibody binding ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were resuspended in lysis buffer (8 M urea, 50 mM EPPS pH 8.5, 150 mM NaCl, Roche protease inhibitor tablet) and lysed by bead beating ...
-
bioRxiv - Cell Biology 2023Quote: Primary human macrophages were washed once with ice cold PBS prior to harvest of cells with TBS supplemented with protease inhibitors (Complete®, Roche) and phosphatase inhibitors (PhosStop® ...
-
Quantitative Comparison of Presenilin Protein Expression Reveals Greater Activity of PS2-γ-SecretasebioRxiv - Cell Biology 2023Quote: ... Cells were scrapped into 100 µl of RIPA lysis buffer (Astral Scientific 786-490) supplemented with protease inhibitor cocktail (Roche 11697498001) and transferred to microfuge tubes ...