Labshake search
Citations for Roche :
3801 - 3850 of 7428 citations for Urea Nitrogen BUN Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2022Quote: ... and brain tissues were homogenized using a Teflon-glass homogenizer in ice-cold homogenization buffer (0.32 M sucrose, 5 mM EDTA, 10 mM Tris-HCl, and pH 7.4, phosphatase inhibitor cocktail tablet; Roche, Mannheim, Germany), centrifuged at 4500 rpm for 10 min at 4°C and the supernatants were collected.
-
bioRxiv - Developmental Biology 2022Quote: ... Ten micrometer cryo-sections were permeabilized with 0.5% Triton X-100/PBS for 10 min and then incubated with blocking buffer (1% blocking reagent [Roche]/TNT) for 1 h ...
-
bioRxiv - Biochemistry 2022Quote: CD14 negative PBMCs were cultured at 5 × 106 cells/ml in RPMI 1640 with 10% FBS in the absence or presence of Phytohemagglutinin (PHA) (1 μg/ml) (Roche) for 24 h.
-
bioRxiv - Biochemistry 2022Quote: Trophozoite stage Hyp1-Nluc parasites at 1% parasitaemia were pelleted by centrifugation at 500g and lysed in 450x pellet volume hypotonic buffer (10 mM Tris-phosphate, 5 mM EDTA, 5 mM DTT, 1x complete protease inhibitor cocktail (Roche) pH 7.4 ...
-
bioRxiv - Plant Biology 2022Quote: ... 200 mM NaCl, 1 mM EDTA, 1%NP-40, 1 mM DTT, 10 mM MgCl2, 1 × protease inhibitor cocktail from Roche) for 2 h at 4°C ...
-
bioRxiv - Pathology 2022Quote: Kidneys and livers were minced into small pieces and digested (1mL; RPMI, GibcoTM ThermoFisher Scientific # 61870044, 0.2 mg/mL Liberase, Roche # 5401127001, 10 µg/mL DNase I, Roche # 10104159001) under shaking (220rpm ...
-
bioRxiv - Developmental Biology 2022Quote: ... and prepared for flow cytometry immunostaining as follows: Matrigel-embedded organoids were digested using a HBSS solution containing 10 U/ml dispase II (Roche) and 125 U/ml of collagenase type IV (Gibco ...
-
bioRxiv - Synthetic Biology 2022Quote: Pellets were lysed via sonication of a 33 percent (w/v) cell suspension in 10 mM Tris pH 7.5/2 mM CaCl2 with protease inhibitor (Roche, 11836170001), cleared with centrifugation at 4C ...
-
bioRxiv - Biochemistry 2022Quote: ... The clarified supernatant was filtered through a 0.45 μM cartridge filter and incubated with 10 mL of cOmplete His- Tag purification beads (Roche, Germany) for 45 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Glycerol was added to a final concentration of 10% as well as Turbonuclease (5 µL) and a protease inhibitor cocktail tablet (Roche). The cells were lysed by sonication (70% amplitude,10 s pulse/10 s pulse off for 2.5 min) ...
-
bioRxiv - Plant Biology 2021Quote: ... excised gel segments were reduced and alkylated with 10 mM dithiothreitol (DTT) and 55 mM chloroacetamide (CAA) followed by digestion with trypsin (Roche). Dried peptides were reconstituted with 0.1% FA in water prior to LC-MS analysis ...
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated for 30 min at 37 °C in a solution (1 ml per well) containing 10 U/ml of dispase II (Roche) and 125 U/ml of collagenase type IV (Sigma ...
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated with α-DIG or α-fluorescein antibody conjugated with alkaline phosphatase (Roche, 1:2000 in 10% FBS/PBST) at 4°C overnight ...
-
bioRxiv - Microbiology 2020Quote: ... pelleted and resuspended in 150 μl sonication buffer [(50 mM Tris pH 8, 1% SDS, 10 mM EDTA, 1x protease inhibitor (Roche)] ...
-
bioRxiv - Molecular Biology 2021Quote: ... un-probed input RNA was also subjected to Sanger sequencing: RNA was dissolved in 5 μl water and supplemented with 1 μl of 10 mM corresponding ddNTP (Roche), then reverse-transcribed into cDNA and analysed by PAGE as described below.
-
bioRxiv - Microbiology 2020Quote: Cells were washed once with ice-cold PBS and lysates harvested at the indicated times post infection with lysis buffer (1% NP-40, 2mM EDTA, 10% glycerol, 150mM NaCl, 50mM Tris HCl) supplemented with protease inhibitors (Roche – complete mini EDTA-free protease inhibitor ...
-
bioRxiv - Molecular Biology 2019Quote: ... The cell pellet was resuspended in cold extraction buffer (10 mM Tris pH 7.5, 2 mM NaV, 50 mM NaF, 50 mM β-glycerophosphate, PhosSTOP Phosphatase inhibitor (Roche), cOmplete EDTA-free Protease Inhibitor Cocktail (Roche) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Subsequently the pellet was resuspended in 45 µl 10 mM sodium phosphate buffer supplemented with EDTA-free Protease Inhibitor Cocktail (Roche) and incubated (5 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... resuspended in nuclear extraction buffer (20mM HEPES pH7.5, 10% glycerol, 350mM NaCl, 0.1% TritonX-100, 1mM DTT, 1mM MgCl2, 0.5mM EDTA, 10mM NaF, Roche protease inhibitor cocktail) and incubated for 30 min at 4°C on a rotator ...
-
bioRxiv - Molecular Biology 2020Quote: ... The crude nuclear pellet was rinsed in wash solution (20mM HEPES pH7.5, 10% glycerol, 150mM NaCl, 0.1% TritonX-100, 1mM DTT, 1mM MgCl2, 0.5mM EDTA, 10mM NaF, Roche protease inhibitor cocktail) twice ...
-
bioRxiv - Neuroscience 2020Quote: ... 10 mM Tris-HCl (pH 7.4) and 1 mg/ml BSA) supplemented with 10 μl of DIG RNA labeling mix (Roche 12039672910) and incubated for 1 h at 37°C with occasional gentle tapping ...
-
bioRxiv - Neuroscience 2021Quote: ... in sucrose lysis buffer (270 nM sucrose, 10 mM Tris-HCl, 1 mM NaHCO3, 1 mM MgCl2, protease inhibitor (cOmplete Mini, Roche), phosphatase inhibitor (PhosphoStop ...
-
bioRxiv - Neuroscience 2021Quote: ... there is a need to stop it after 2 hours by a single injection of diazepam (Valium®, 10 mg×kg−1, i.p.; Roche). Rats were then hydrated with 2 mL of saline solution (0.9% NaCl ...
-
bioRxiv - Biophysics 2021Quote: ... including 200 μM final concentration of each dNTP (G,C,T,A) and 10 µM Bio-16-dUTP or Dig-11-dUTP (all from Roche). Labelled handles specifically bind either to a glass surface covered with anti-digoxigenins or to superparamagnetic beads covered with streptavidin ...
-
bioRxiv - Pathology 2022Quote: ... 2 μl of cDNA in RNase free water was made up to 20 μl with FastStart Universal SYBR Green Master (ROX, 10 μl, Roche), Ultra Pure Water (6.4 μl ...
-
bioRxiv - Genomics 2022Quote: Human embryonic hindlimb muscles were collected in sterile PBS and mechanically dissociated using fine scissors in 10 mL (per gram of tissue) of enzyme solution containing 2.5 U/mL Dispase II (Roche, #4942078001) and 1 mg/mL Collagenase B (Roche ...
-
bioRxiv - Genomics 2022Quote: ... Tissue was then mechanically dissociated with fine scissors in 10 mL (per gram of tissue) enzyme solution mixed with 2.5 U/mL Dispase II (Roche, #4942078001) and 1 mg/mL Collagenase B (Roche ...
-
bioRxiv - Cell Biology 2022Quote: 2 μL of FLAG or IgG pull down and of a 1:10 dilution of the INPUT were used for amplification using qPCRBIO SyGreen Mix (PCR Biosystem) in a LightCycler96 (Roche) instrument ...
-
bioRxiv - Developmental Biology 2020Quote: ... Nuclei were pelleted by centrifugation and resuspended in sonication buffer (50 mM Tris-HCl pH 8, 1% SDS, 10 mM EDTA, 1x cOmplete ULTRA Tablet (Roche)) and sonicated using a Bioruptor sonicator (Diagenode ...
-
bioRxiv - Molecular Biology 2019Quote: ... for 1 h at 37°C and protein was removed by incubation with 10 μL of proteinase K (18 mg/mL; Roche) for 2 h at 65°C ...
-
bioRxiv - Biophysics 2019Quote: ... 10 mM Na4P2O7 and 10 mM EDTA supplemented with 1% (v/v) Triton X-100 and one complete protease inhibitor cocktail tablet (Roche)) ...
-
bioRxiv - Genetics 2019Quote: ... cells were vortexed and passed through a syringe in ubiquitin lysis buffer (2% SDS, 150mM NaCl, 10 mM Tris HCl pH 8, 1 Roche protease inhibitor tablet ...
-
bioRxiv - Cancer Biology 2020Quote: A unique Fluidigm barcode was added to each sample by PCR in 10 μl reactions using the Fast Start High Fidelity PCR System (Roche) containing ...
-
bioRxiv - Plant Biology 2019Quote: ... 60 mM KOAc, 10 mM MgOAc, 0,5% [v/v] Nonidet P-40 and proteinase inhibitor cocktail [cOmplete™, COEDTAF-RO, Roche]). After a solubilization step (15 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... was designed to tile a 250 bp capture region within the central 4-kb target region from each 10-kb window of hg19 avoiding non-specific sequences by Roche so that the maximum distance between 2 capture regions is 14-kb ...
-
bioRxiv - Systems Biology 2019Quote: ... 3.5 µl of diluted samples was used to assemble a 10 µl reaction and run on a Light Cycler 480 II (Roche) with the primers CAGAGTTCTACAGTCCGACGAT and TTGGCACCCGAGAATTCCA (matching each probe’s ends ...
-
bioRxiv - Molecular Biology 2020Quote: ... Transfected cells were harvested in ice-cold PBS using a cell scraper and lysed by sonication for three times 10 seconds in ice-cold PBS containing Complete protease inhibitors (Roche). Unbroken cells were removed by centrifugation at 500 g for 2 minutes ...
-
Single cell transcriptomics reveals the effect of PD-L1/TGF-β blockade on the tumor microenvironmentbioRxiv - Genomics 2020Quote: ... anti-PD-L1 (10 mg/kg for the first dose with each subsequent dose at 5 mg/kg; atezolizumab, Roche), anti-TGF-β (10 mg/kg ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were washed in MABT buffer for one hour and NTMT buffer for 10 min and incubated in NBT/BCIP (Roche) for the coloring reaction ...
-
bioRxiv - Cell Biology 2020Quote: Trichonympha and Teranympha cells were extracted from the hindgut of termites in 10 mM K-PIPES in the presence of cOmplete protease inhibitor cocktail (1:1000; Roche) as described (Guichard et al ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 mM MgCl2, 10% glycerol, 1% Tween-20, 20 mM imidazole, 1 mg/ml lysozyme, and 1x protease tablet [Roche]) for thirty minutes on ice with 5 min intervals of 10 s vortexing ...
-
bioRxiv - Plant Biology 2020Quote: ... in a reaction volume of 20 μL containing 10 μL of the LightCycler 480 SYBR Green I Master Mix (Roche), 0.3 μM of each specific forward and reverse primer (Table S9 ...
-
bioRxiv - Microbiology 2020Quote: After adding 1 mL of PBS (pH 7.4) containing protease inhibitor (1 tablet per 10 mL, Roche cOmplete™, #04693159001) and 500 μL of 0.5 mm diameter glass beads ...
-
bioRxiv - Microbiology 2021Quote: ... The cell pellet was resuspended in 10 ml PdeL purification buffer and one tablet of c0mplete mini EDTA-free protease inhibitor (Roche) and a spatula tip of DNase I (AppliChem ...
-
bioRxiv - Genomics 2019Quote: ... the cells were transfected with 10 μg of the plasmid libraries (HSS, ORI, and pGL4) using X-tremeGENE HP (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... Each sample was run in triplicate using a 10 μl reaction volume consisting of: 5 μl of CyberGreen Mastermix (Roche), 0.5 μl forward primer (30 μM) ...
-
bioRxiv - Immunology 2019Quote: A single-cell suspension of lung cells was obtained by mincing whole mouse lungs in RPMI and then digesting each lung in 5 mL of RPMI + 10% FCS with 1 mg/mL Collagenase A (Roche) and 2000 U/mL of DNAse I for 45 minutes in a shaking incubator at 37°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... and blocked in 10% Sheep Serum for 2 hours followed by incubation with an anti-DIG antibody (1:2000) (Roche) in TBST / 1% sheep serum overnight at 4°C ...
-
bioRxiv - Biochemistry 2019Quote: ... with buffer II with protease inhibitors (8 μg/ml Aprotinin, 10 μg/ml Leupeptin, 1 μg/ml Pepstatin, 1 mM PMSF and 2 tablets cOmplete Mini, EDTA free; Roche) and 2 times flash frozen in liquid Nitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.5 % sodium deoxycholate and 1 % Triton X-100 as well as protease inhibitors (10 mg / ml leupeptin, pepstatin A, 4-(2-aminoethyl) benzensulfonyl-fluorid and aprotinin) and phosphatase inhibitors (PhosSTOP−, Roche). Total cell lysates were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis ...