Labshake search
Citations for Roche :
301 - 350 of 3695 citations for ssc mir 487b RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... 2.5µL diluted cDNA was used as template in a 10µL qRT-PCR reaction performed in duplicate using gene-specific primers and Kapa SYBR Green Universal qPCR mix (KAPA Biosystems) according to manufacturer’s instructions using a BioRad CFX Connect Real-Time PCR System ...
-
bioRxiv - Cancer Biology 2019Quote: Real-time PCR analysis of cDNA samples was performed with specific primers and probes designed by using Assay Design Center (Roche). Primers and probes used here are available upon request ...
-
bioRxiv - Genetics 2021Quote: ... The PCR was performed with single sense (negative control) or antisense primers in presence of DIG-labelled deoxynucleoside triphosphates (dNTPs) (Roche). Freshly hatched J2s were fixed and hybridized with the probes following the protocol of de Boer et al ...
-
bioRxiv - Physiology 2021Quote: ... gDNA regions were amplified via PCR using 1/150th gDNA and 300nM forward and reverse primers in a 50 μL FastStart PCR Master Mix reaction (Roche). PCR products were purified using QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2020Quote: ... reverse transcribed with qScript cDNA SuperMix (Quanta Biosciences) and primer-specific amplified with the quantitative PCR MasterMix FastStart Universal SYBR Green (Roche) or the TaqMan® Universal Master Mix II when using the Universal Probe Library (Roche) ...
-
bioRxiv - Microbiology 2021Quote: Wildtype genes were amplified by PCR from JE2 genomic DNA using the primers shown in table 4 and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using KpnI and SacI restriction sites and T4 DNA ligase (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... the V4 region of the 16S rRNA gene was amplified with barcode primers containing the index sequences using a KAPA HiFi HotStart Real-time PCR Master Mix (Roche). We monitored PCR product amplification and concentration on a Bio-Rad CFT Connect Real-Time PCR system ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR was performed with 500 nM of oligo U1 and U2 primer in 2x KAPA HiFi HotStart Uracil+ ReadyMix (Roche) in 50 μl ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR primers for Rpl8 and Ifna4 were used as given above together with the universal probe library probes (UPL, Roche) #5 and #3 ...
-
bioRxiv - Microbiology 2023Quote: Wildtype genes were amplified by PCR from JE2 genomic DNA using the primers shown in Table 3 and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC226 using KpnI and SacI restriction sites and T4 DNA ligase (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... in a 0.8× ratio and then amplified using standard indexed Illumina primers as previously described69 using the Expand Long Template PCR System (Roche). Second-round PCR products were purified with PCR purification columns (Qiagen ...
-
bioRxiv - Immunology 2023Quote: ... Real-time PCR was performed using qPCR primer pairs listed in Table S2 and LightCycler480 SYBR Green I Master Mix (Roche) in a LightCycler480 instrument ...
-
bioRxiv - Microbiology 2023Quote: ... Probes were obtained by PCR using the primers pGK-S55 and pGK-S53 (Table S1) and labelled with the PCR DIG Probe Synthesis Kit (Roche) according to the manufacturer and revealed using the DIG Luminescent Detection Kit and DIG Easy Hyb (Roche).
-
bioRxiv - Molecular Biology 2023Quote: ... Converted DNA was used as a substrate for PCR amplification of the below endogenous CTCF sites using bisulfite-compatible primers and KAPA HiFi Uracil+ (Roche) ([95 °C ...
-
bioRxiv - Developmental Biology 2019Quote: ... slides were washed in 0.2x SSC then transferred to MBST before blocking with 2% blocking solution (Roche) for at least 1 hr at RT ...
-
bioRxiv - Genomics 2024Quote: ... the embryos were transferred to pre-hybridization buffer (50% deionized formamide, 5x SSC pH 4.5, 2% Roche Blocking Reagent ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primers (see primer table) were designed on the Universal Probe Library website (Roche).
-
bioRxiv - Genomics 2020Quote: ... 10% of undiluted cDNA was loaded into each RT-PCR according to manufacturer’s instructions using SYBR Green I Master (Roche, 04707516001). qPCR primers can be found in Table S4.
-
bioRxiv - Developmental Biology 2019Quote: ... For real-time RT-PCR, the cDNA was amplified with TaqDNA Polymerase (Toyobo Sybr Green Plus, Osaka, Japan) using a light cycler (Roche). Gapdh was used as a housekeeping gene ...
-
bioRxiv - Microbiology 2020Quote: ... Ten µl of extracted RNA was used to perform the real-time RT-PCR with the LightCycler® 480 (Roche) in Pitié Salpêtrière hospital or the ABI Prism® 7500 SDS (Applied Biosystems ...
-
bioRxiv - Microbiology 2019Quote: ... and the ketoreductase-B domain of the mycolactone polyketide synthase genes (KR-B) [22] using RT-PCR reagents from Roche PCR Kit (Roche Diagnostics ...
-
bioRxiv - Biochemistry 2022Quote: ... I analyzed samples by real-time reverse transcriptase polymerase chain reaction (real-time RT-PCR) using a Light Cycler 1.5 (Roche Diagnostics). Measurements form RNA of vascular cell adhesion molecule-1 (VCAM-1 ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA synthesis and nested PCR amplification of the HCV coding sequence and parts of the noncoding sequence was done in three overlapping fragments with the Expand-RT and Expand-long-PCR system (Roche) using primers and protocols as described for Con1 (Table S1 ...
-
bioRxiv - Microbiology 2019Quote: One-step simplex real-time quantitative RT-PCR amplifications were performed using Multiplex RNA Virus Master Kit (Roche Diagnostics, France) for influenza A ...
-
bioRxiv - Microbiology 2019Quote: ... AHSV4 WT strain (isolated in Morocco in 1990 (80)) and EEV3 WT strain (isolated in South Africa in 1974 (81)) were amplified by RT-PCR (Roche) from purified infected-cell RNAs ...
-
bioRxiv - Immunology 2020Quote: ... reverse transcription and quantitative RT PCR as shown in Figure 8d was performed as published 56 using the universal probes systems (Roche). Primers for Rc3h1 (F ...
-
bioRxiv - Cell Biology 2021Quote: ... Quantitative RT-PCR was performed using TB Green Premix ExTaq II (Takarabio, Otsu, Japan) and a LightCycler96 (Roche Basel, Switzerland). Primers used for qPCR are listed in Table S1.
-
bioRxiv - Developmental Biology 2022Quote: ... Canada). RT-PCR was performed using the UltraSYBR Mixture (cat. # CW0957, Cowin Bio, China) on a LightCycler 480 instrument (Roche). The results were analyzed based on the 2-ΔΔCt method to calculate the fold changes ...
-
bioRxiv - Neuroscience 2023Quote: ... The RT-qPCR was performed using Sensitive RT HS-PCR Mix (A&A Biotechnology,2017-149 2000) on the Light Cycler 480 (Roche) under the following conditions ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples for RT-PCR were run in duplicate using FAM-labelled probes or SYBR green dsDNA-intercalating fluorescent dye (Roche) in a StepOne Real-Time PCR system (Applied Biosystems ...
-
bioRxiv - Biochemistry 2023Quote: ... was used for cDNA synthesis and RT-qPCR was performed using KAPA SYBR FAST qRT PCR kit (KK4602, KAPA Biosystems). Taf10 was used as a control for normalisation and the fold change in mRNA levels were calculated by 2^-ddct method.
-
bioRxiv - Microbiology 2024Quote: ... and 1 μL of the reverse transcrip-tion mix from the Titan One Tube RT-PCR System kit (Roche, Switzerland) was added ...
-
bioRxiv - Microbiology 2024Quote: ... RT-qPCR was performed using the Luna Universal One-Step RT-qPCR Kit (Biolaps) according to the manufacturer protocol on a LightCycler real-time PCR thermocycler (Roche). The analysis of the infection rate based on PCR data was done with the binGroup package [42] in R software.
-
bioRxiv - Microbiology 2020Quote: ... qRT-PCR reactions (10 µl) were set up in Light cycler 480 plates using the LightCycler 480 probe master mix (Roche, Welwyn Garden City UK) according to the manufacturer’s instructions (Tables 2) ...
-
bioRxiv - Neuroscience 2020Quote: ... xCELLigence RT-CA (Roche) to monitor motility of hMSCs ...
-
bioRxiv - Genomics 2020Quote: DIG Wash and Block Buffer Set (Roche 11585762001)
-
bioRxiv - Microbiology 2022Quote: ... Porcine trypsin and the Protease Inhibitors Set (Roche) were purchased from Sigma ...
-
bioRxiv - Genomics 2020Quote: ... The oligonucleotide pool was PCR-amplified in 10 cycles (Primers stated in Supplemental Information) and KAPA® HiFi HotStart Polymerase (Roche) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... mgc2 adhesin and mgc2-like adhesin (list of primers used in Table 2) were made by real-time PCR (rtPCR) on LightCycler 96 thermocycler (Roche®). The LightCycler SYBR Green I Master reaction mix (Roche® ...
-
bioRxiv - Neuroscience 2020Quote: All qPCR reactions were performed in 10 μl volume in triplicates with 1× HOT FIREpol EvaGreen qPCR Mix Plus (Solis Biodyne) and primers listed in Supplementary Table 1 on LightCycler® 480 PCR instrument II (Roche). Gene expression levels were normalized to HPRT1 mRNA levels in neurons and Cyclophilin B mRNA levels in astrocytes ...
-
bioRxiv - Microbiology 2020Quote: ... or the 5’-flanking region of Bcflp2 (amplified with Probe2For and Probe2Rev primers) using the PCR DIG Probe Synthesis Kit and the DIG Luminescent Detection Kit (Roche, Germany) following manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2022Quote: ... A universal primer was annealed to the barcoded adapter and one of 24 indexed primers was annealed to the universal adapter followed by PCR amplification using KAPA HiFi Hotstart Readymix (Kapa BioSystems). This design ensured that only DNA sequences with both ligated adapters will be sequenced ...
-
bioRxiv - Microbiology 2019Quote: ... and Southern hybridization with blaKPC and rep IncFIIK DIG-labelled probes (16) prepared using published primers (35,36) and the PCR DIG Probe Synthesis Kit (Roche, Mannheim, Germany) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: All libraries were amplified off the array using the primers indicated in Supplemental Table 10 with KAPA HiFi HotStart Uracil+ ReadyMix PCR Kit (Kapa Biosystems) as described above ...
-
bioRxiv - Cancer Biology 2020Quote: ... to amplify the ligation product with 5 PCR cycles using 2x KAPA-HiFi HS Ready Mix and 10X KAPA primer mix (Roche Kapa Biosystems). The libraries were sequenced on HiSeq 4000 or NovaSeq 6000 (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... Junction PCR was performed in quintuplicate for each replicate with 20 uL cDNA and 10 uM input Forward and Reverse Junction Primers (Table S16) using KAPA HiFi 2x PCR Master Mix (KAPA Biosystems) with the following conditions ...
-
bioRxiv - Immunology 2020Quote: ... First round of PCR amplification was performed using primers CGTTCAGAGTTCTACAGTCCGACGATCHHHHACHHHHACHHHNGCAGCCCATGGTACCA GCAGTTCC and ACTGGAGTTCCTTGGCACCCGAGAATTC using HotStart Kappa HIFI ready mix (Kapa Biosystems) and the following conditions ...
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...
-
bioRxiv - Immunology 2022Quote: Purified DNA from mouse fecal pellets or sorted cells was subjected to 16S variable region 4 PCR amplification using barcoded 515F and 806R primers (47) and the KAPA2G Robust HotStart ReadyMix (KAPA Biosystems), with the following cycling conditions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Fixed embryos were placed into hybridization buffer (50% formamide, 5×SSC, 1 mg/ml yeast tRNA (Roche, 10109223001), 100 μg/ml heparin (Sigma-Aldrich ...