Labshake search
Citations for Roche :
201 - 250 of 3695 citations for ssc mir 487b RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... and all reactions were set up according to manufacturer’s protocols on a LightCycler 96-well real-time PCR machine (Roche). The following cycling parameters were employed ...
-
bioRxiv - Microbiology 2022Quote: ... DNA probes were synthesised using the designed primers followed by PCR DIG-probe Synthesis kit (Roche) according to the manufacturer’s instructions in 50μl reaction volumes ...
-
bioRxiv - Cancer Biology 2019Quote: ... The primers used for real-time PCR were designed based on the Universal Probe Library (Roche, Roche Life Science ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Cell Biology 2023Quote: ... qRT-PCR was performed using specific primers and the LightCycler 480 SYBR Green I (#04887352001, Roche) on a LightCycler 480 (Roche) ...
-
bioRxiv - Pathology 2021Quote: ... A quantitative real time polymerase chain reaction (q-RT-PCR) was used to quantify the parasite load by using PCR SYBER Green Master Mix (Roche, Applied Science, CT) containing MgCl2 by employing QuantStudio 3 Real-Time PCR system (Thermo Fisher) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Real-time quantitative RT-PCR (Q-PCR) was performed in 384-well plates using the LightCycler® Multiplex DNA Master (Roche Life Sciences) and hybridization probes from the Universal Probe Library Set (Roche Life Sciences) ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative RT-PCR was performed on cDNA using LightCycler 480 SYBR Green I Master Mix (Roche) and the primers listed in table I on a LightCycler 480 II ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative RT-PCR was performed on cDNA using LightCycler 480 SYBR Green I Master Mix (Roche) and the primers ttgacccgtaaatctgaagctaat-Ccl2F ...
-
bioRxiv - Neuroscience 2019Quote: ... Quantitative RT-PCR was performed using FastStart SYBR green master mix (Roche Applied Science, Indianapolis, IN) with the reaction volume 20μl per well (10μl SYBR green master mix 2X ...
-
bioRxiv - Cancer Biology 2020Quote: ... The q-RT-PCR experiments were conducted using SYBR Green and a Lightcycler96 (Roche, Indianapolis, USA).
-
bioRxiv - Plant Biology 2021Quote: ... RT-PCR was performed using 96 well plates in a LightCycler® 480 Instrument by Roche. PCR reactions were performed using KAPA SYBR FAST qPCR Master Mix kit by Kapa Biosystems ...
-
bioRxiv - Cell Biology 2021Quote: ... Quantitative RT-PCR was performed using the FastStart Universal SYBR Green Master (ROX) (Roche, Mannheim, Germany) in a Step One Plus Real-Time PCR system (Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... RT-PCR was performed using the LightCycler Multiplex RNA Virus Master Kit (Roche Diagnostics, Mannheim, Germany) on a Cobas z480 analyzer (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative real-time PCR (RT-qPCR) assay was performed using FastStart Essential DNA Green Master (Roche) on a CFX Connect™ Real-Time System (Bio-Rad) ...
-
bioRxiv - Genomics 2020Quote: ... Reverse transcribed cDNA was then assayed for RT-qPCR using Sybr green PCR kit (KAPA biosystems) at 60°C melting temperature and quantitated using Biorad quantitative PCR system ...
-
bioRxiv - Microbiology 2019Quote: RT-PCR was performed using LightCycler® RNA Amplification Kit SYBR Green (Roche Diagnostics Ltd., UK). The primers were (csf2-fw ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-PCR was carried out for 25 cycles using 2x KAPA Taq ready-mix (Kapa Biosystems) in 50 µl reactions containing 80 ng cDNA and 400 nM primers each ...
-
bioRxiv - Physiology 2022Quote: ... The mRNA expression was measured by quantitative RT-PCR using the Universal Probe Library (Roche, UK). Primer sequences and probe numbers are given in Supplemental table 1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Quantitative RT-PCR was performed with a Light Cycler 480 SYBR Green IMaster (Roche Applied Science) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... and samples cDNA and the quantitative RT-PCR was carried out with a LightCycler 480 (Roche). Results were quantified by a comparative Ct method and normalized using the 5 housekeeping genes included in the array.
-
bioRxiv - Immunology 2022Quote: ... The RT-PCR reactions were carried out using the Light Cycler 480 II (Roche, Basel, Switzerland). The relative expression of AhR was normalized to the house keeping gene 28S rRNA ...
-
bioRxiv - Systems Biology 2023Quote: Quantitative RT-PCR was carried out using the KAPA SYBR FAST qPCR master mix (Kapa Biosystems) with samples pre-incubated at 95 °C for 3 minutes then 40 cycles of 95 °C for 10 seconds ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA was obtained after reverse transcription using a First strand cDNA synthesis RT-PCR kit(Roche) and quantitative PCR was performed using SYBR Green (Roche ...
-
bioRxiv - Plant Biology 2023Quote: Transcript levels were assessed by quantitative RT-PCR using a Light Cycler® 480 System (ROCHE), as previously described by (Gutierrez et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... Real-time quantitative PCR reactions from 8,3 ng of cDNA were set up in triplicate using a LightCycler DNA SYBR Green I Master PCR machine (Roche). The oligonucleotides used in qRT-PCR experiments are provided in SI6.
-
bioRxiv - Cell Biology 2019Quote: All genotyping was done using the HotStart Mouse Genotyping Kit with its instructed PCR reaction set up from KAPA Biosystems. For the NF1Afl/fl genotype ...
-
bioRxiv - Plant Biology 2023Quote: ... The qRT-PCR was set up as a 10μL reaction using SYBR® Green 1 480 Lightcycler® Master (Roche) in a 384-well plate ...
-
bioRxiv - Genomics 2022Quote: ... a PCR was performed with primers containing NGS sequences (KAPA HiFi HotStart ReadyMix, Kapa Biosystems, 12 cycles), and the library was cleaned using 0.8x SPRI beads.
-
bioRxiv - Cancer Biology 2021Quote: ... SYBR green (see primers list) or Taqman based Quantitative PCR (hprt: Roche universal probe library #95 (agtcccag); Ras ...
-
bioRxiv - Microbiology 2022Quote: ... amplified using primers LN112 and LN113 (Table 2) and the PCR DIG Synthesis Kit (Roche, Basel, Switzerland) as a probe ...
-
bioRxiv - Genomics 2023Quote: ... and PCR using NEB ultra mastermix (M0544S) and 10X KAPA Library Amp Primer Mix (Kapa Biosystems, KK2623). Samples were sequenced using a NovaSeq SP kit (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... and amplified with KAPA HiFi HotStart Real-time PCR using KAPA P5 and P7 primers (KAPA Biosystems).
-
bioRxiv - Microbiology 2020Quote: ... The cDNA was then amplified using an SYBR green RT-PCR kit (06924204001, Roche Products, Mumbai, India) for a 139 bp region in the Tat exon-1 using the primers- N1783 (5’- GGAATCATCCAGGAAGTCAGCCCGAAAC-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... Quantitative RT-PCR was performed using LightCycle®480 SYBR Green I Master (Roche, Indianapolis, IN, USA), on a Light Cycler 480 Detection System (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... One step real time RT-PCR was performed using the RNA Process Control Kit (Roche, Basel, Switzerland) with 5 μl of extracted RNA or directly from 5 μl of heated sample ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Quantitative real-time PCR (RT-qPCR) was carried out in a LightCycler 96 System (Roche, Basel, Switzerland) using a KAPA SYBR FAST qPCR kit (KAPA Biosystems ...
-
bioRxiv - Pathology 2021Quote: ... RNAs were reverse transcribed using first strand cDNA synthesis kit for RT-PCR (Roche Diagnostics, Meylan, France), according to the manufacturers’ protocols ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative analysis RT-PCR was performed in triplicate using SYBR Green I Master Mix (Roche Life Science) and LightCycler 480 instrument (Roche Life Science) ...
-
bioRxiv - Plant Biology 2022Quote: ... RT-PCR was performed using a LightCycler 480 SYBR Green I Master kit (Roche Diagnostics, Indianapolis, US) and a Roche LightCycler (Roche Diagnostics ...
-
bioRxiv - Neuroscience 2023Quote: ... or the Sensitive RT HS-PCR Mix (2017-2000, AA Biotech, Gdansk, Poland) on the LightCycler480 (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Reverse transcription was performed using first-strand cDNA synthesis kit for RT-PCR (Roche Diagnostics, Basel, Switzerland). qPCR was then performed on a LightCycler™ (Roche Diagnostics ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was performed on the resulting cDNA using a LightCycler 96 Real-Time PCR system (Roche) and Luna Universal qPCR Master Mix kit (New England Biolabs) ...
-
bioRxiv - Cell Biology 2024Quote: ... Real-time quantitative RT-PCR reactions were run on LightCyclerTM 480 Instrument II System (Roche Life Science) using PowerUpTM SYBERTM Green Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2020Quote: ... Primer efficiencies were evaluated by RT-qPCR using LightCycler® 480 SYBR Green I Master and LightCycler® 480 instrument II (Roche, Bâle, Switzerland). Gene expression was quantified using the Biomark microfluidic system ...
-
bioRxiv - Genomics 2020Quote: ... were subjected to linear PCR (10μl reaction volume) using primer EF170 and 5μl 2x KAPA HiFi HotStart ReadyMix (Roche) and cycling conditions 98°C 2min ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were amplified by adding 2.5 µl NEBNext dual index primers and 12.5 ul KAPA HiFi 2x PCR mastermix (Roche). PCR was carried out for 12-16 cycles and thereafter the PCR reactions were purified twice with 0.8x SPRI beads and finally eluted in 10 µl elution buffer (10 mM Tris pH 8.0) ...
-
bioRxiv - Immunology 2020Quote: ... and IgA) primers were used to amplify VH-region sequences using polymerase chain reaction (PCR high fidelity, Roche); separate PCR reactions for each VH-family were performed to avoid cross-priming or primer competition ...
-
bioRxiv - Immunology 2020Quote: ... and IgM repertoires was amplified with a multiplex primer set5 using the FastStart High Fidelity PCR System (Roche) under the following conditions ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR primers for the genes of interest were designed by the Universal Probe Library Assay Design Center (Roche) (primer sequences listed in key resource table).