Labshake search
Citations for Roche :
3401 - 3450 of 3510 citations for 4 Chloro 2 iodothieno 2 3 b pyridine 5 carbonitrile since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Arterial samples to measure whole blood glucose concentrations were taken every 5-15 minutes and analysed using a handheld blood glucose meter (Accu-Chek® Aviva, Roche) to minimize blood volume sampling ...
-
bioRxiv - Physiology 2024Quote: ... for 45 s at 6,000 rpm×3 (and placed on ice for 5 min at the end of each 45 s homogenization) using a Roche MagNA Lyser instrument (Roche, Germany). RNA was extracted using standard Tri-Reagent procedure via chloroform/isopropanol extractions and 75% ethanol washing as per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: Bacterial cell pellets were resuspended in 50 ml of lysis buffer (50 mM Tris-HCl pH 8, 1 mM DTT, 5% glycerol, protease inhibitor cocktail [Roche 1183615300]). Cells in pellets were lysed by sonication on ice with 10 sec pulses of maximum setting followed by 1 min cooling period ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and cell pellets were resuspended in twice their volume of buffer A (50 mM HEPES pH 7.5, 500 mM KCl) with 5 mM MgCl2 and DNase I (Roche, Basel, Switzerland). Cells were lysed by sonication using a SonoplusGM200 (BANDELIN electronic GmbH & Co ...
-
bioRxiv - Molecular Biology 2024Quote: ... Pellets of CoREST and LSD1 were resuspended in lysis buffer (50 mM NaH2PO4 pH 8.0, 300 mM NaCl, 5% glycerol, 7.5 mM imidazole supplemented with PMSF, DNAse and EDTA-free Roche protease inhibitor cocktail) in a weight ratio of 1:1.5 ...
-
bioRxiv - Systems Biology 2024Quote: ... equimolar amounts of oligo pool and reverse primer (Supplemental Table 5: Oligo Library cloning R: cttgctatgctgtttccagc) were mixed with 2X KAPA HiFi master mix (Roche, 07958935001) and incubated for 10 min at 72°C ...
-
bioRxiv - Neuroscience 2024Quote: Fresh frozen brains were weighed and homogenized with 4X w/v HSAIO buffer (50 mM Tris base, 274 mM NaCl, 5 mM KCl, pH 8.0) with protease (Pierce, cat# A32955) and phosphatase (Roche, cat# 04906845001) inhibitors using a motorized mortar and pestle ...
-
bioRxiv - Cell Biology 2024Quote: ... Programmed cell death was visualized with TUNEL assay according to manufacturer’s instructions for TUNEL TMR red kit (11767291910, 5% TUNEL enzyme; Roche Diagnostic Corp).
-
bioRxiv - Neuroscience 2024Quote: ... slides were blocked with 5% lamb serum diluted in TBST and incubated with an anti-digoxigenin antibody conjugated to Alkaline phosphatase (1/2000, Roche, 11093274910) overnight at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... lysis buffer (50 mM Tris pH 7.5, 50 mM potassium acetate, 5 % v/v glycerol, 0.3 % v/v Triton X-100, Roche complete protease inhibitor)25,27,35 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 0.6 to 5 nanograms of enriched DNA was used for library preparation using the Kapa HyperPrep Kit (Roche, Cat. # 07962347001) following EpiCypher’s parameters for indexing PCR and library amplification as described in the CUT&RUN Library Prep Manual ...
-
bioRxiv - Biochemistry 2024Quote: ... were harvested by centrifugation and resuspended in 25 ml lysis buffer (20 mM Tris-Hcl, pH 7.5 + 200 mM Nacl + 1 mM DTT + 5% Glycerol) and protease inhibitor (Roche, Basel, Switzerland). The suspended cells were disrupted by sonication and then cell debris was separated by centrifugation at 12,000 rpm for 45 min.
-
GRASP55 Safeguards Proper Lysosome Function by Controlling Sorting of Lysosomal Enzymes at the GolgibioRxiv - Cell Biology 2024Quote: ... in TBS-T buffer [50 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.1% Tween-20 (#A1389, AppliChem)] or with 5% BSA (#10735086001, Roche; #8076, Carl Roth) in TBS-T for phosphoprotein immunoblots ...
-
bioRxiv - Developmental Biology 2024Quote: ... and used in a 10 μL RT-qPCR reaction composed of 5 μL 2x KAPA SYBR FAST qPCR Master Mix (Roche, KK4600), 2.5 μL cDNA ...
-
bioRxiv - Systems Biology 2021Quote: The digested lysates were mixed 1:1 with 2x IP buffer (200 mM Tris, pH 8.0; 600 mM NaCl; 4% Triton X-100; 2x Roche Complete EDTA-free protease inhibitors), and then kept on ice for no more than a few hours prior to antibody addition ...
-
bioRxiv - Immunology 2020Quote: ... Lyzed cells were centrifuged at 20,000 x g for 30 min at 4°C and the supernatant was mixed with protease inhibitor (cOmplete ULTRA Tablets, Roche, Sigma-Aldrich, Cat: 05892953001). Protein concentration was determined using the Qubit Protein Assay Kit and Fluorometer (Invitrogen) ...
-
bioRxiv - Bioengineering 2021Quote: ... expanded leaves of 7-week old hybrid aspen plants were sampled with a biopsy punch (4 mm diameter) and loaded into wells of 96-well plate (Roche LightCycler® 480 System) containing 100 μL of water (one sample per well) ...
-
bioRxiv - Physiology 2022Quote: ... This was followed by a perfusion at 4 mL/min for 40 min with the same solution containing 1 mg/mL of collagenase A (Roche Diagnostics GmbH, Mannheim, Germany) plus 300 µM ethylene glycol tetraacetic acid (EGTA ...
-
bioRxiv - Developmental Biology 2021Quote: ... Probes were hybridized at 56°C overnight and subsequently detected by anti-DIG at 4°C overnight (1:1000; Roche 11-207-733-910) with secondary tyramide signal amplification for 2h at room temperature in the dark (AKOYA Biosciences ...
-
bioRxiv - Zoology 2023Quote: ... Paired-end cDNA libraries were constructed from 4 μg of total RNA using a KAPA Stranded mRNA-Seq Kit (Kapa Biosystems, Inc., Wilmington, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Zoology 2024Quote: ... Samples were pre-incubated for 2 h in blocking solution (25% deactivated goat serum in PBT) and incubated overnight at 4°C in blocking solution with anti-DIG antibody conjugated to alkaline phosphatase (Roche Diagnostics, Germany; 1:2000). After several washes in PBT ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM MgCl2, 1 mM EGTA, 0.1% [v/v] NP-40, 1 mM DTT, 5% [v/v] glycerol and Roche Complete Protease Inhibitors) and homogenized using a high-performance disperser (Fisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... ESCs or HEK293T cells were harvested and lysed in TEN buffer (50 mM Tris-HCl, 150 mM NaCl, 5 mM EDTA, 1% Triton X-100, 0.5% Na-Deoxycholate, supplement with Roche cOmplete Protease Inhibitor). The lysates were quantified by the Bradford method and equal amount of proteins were loaded for Western blot assay ...
-
bioRxiv - Immunology 2021Quote: ... ATAC-seq libraries were amplified using 5 μl each of the i5 and i7 Nextera Indexing primers and 25 μl of 2x HiFi HotStart ReadyMix (Roche Diagnostics, KK2601). Final libraries were purified using 1x volumes of AMPureXP SPRI-beads and sequence using 75bp paired-end reads on an Illumina NextSeq500.
-
bioRxiv - Genomics 2022Quote: ... 0.1% NP-40 and 5 mM β-mercaptoethanol) supplemented with fresh protease inhibitors (AEBSF, Complete™ EDTA-free Protease Inhibitor Cocktail, Roche). Emulsions were snap-frozen in droplets in liquid nitrogen and cells subjected to cryogenic grinding using a Ball Mill MM 400 (5 cycles of 3 minutes at 20 Hz) ...
-
bioRxiv - Microbiology 2021Quote: The body weight of all mice was recorded weekly and blood glucose (BG) levels were measured every 5 weeks after fasting for 12 h using a glucose analyzer (Accu-Chek; Roche, Rotkreuz Switzerland) over the tail vein ...
-
bioRxiv - Microbiology 2020Quote: ... G355-5 cells were transfected with 1 to 6 µg DNA in 6 cm dishes using X-treameGENE 9 (Roche, Basel, Switzerland). The 293T/17 cell line was obtained from ATCC (CRL-11268 ...
-
bioRxiv - Cancer Biology 2021Quote: We established single-cell suspensions of surgically resected tumors by taking a small piece of PDAC tumor tissue collected in a cell-dissociation media [5 ml of minimal essential media (MEM) containing 100μl of Liberase-TM (2.5 mg/ml stock solution Roche/Sigma Aldrich Cat# 5401046001), 50μl of Kolliphor®P 188 (15 mM stock solution Sigma Cat# K4894) ...
-
bioRxiv - Cancer Biology 2022Quote: For antibody incubation 5 µl of the DigiWest Bead mixes were added to 50 µl assay buffer (Blocking Reagent for ELISA (Roche, Rotkreuz, Switzerland) supplemented with 0.2% milk powder ...
-
SARS-CoV-2 Point Mutation and Deletion Spectra, and Their Association with Different Disease OutcomebioRxiv - Microbiology 2022Quote: ... Each region was amplified from 5 μl of the RNA preparation by RT-PCR using Transcriptor One Step RT-PCR kit (Roche Applied Science). To perform the RT-PCR ...
-
bioRxiv - Plant Biology 2022Quote: ... 0.2% NP-40, 10% glycerol, 1 mM EDTA, 1 mM PMSF, 20 µM MG132, 5 mM DTT and Roche protease inhibitor #5892953001), and incubated for 1 h on a rotating wheel ...
-
bioRxiv - Biochemistry 2022Quote: ... 0.1% NP-40 and 5 mM β-mercaptoethanol) in the presence of protease inhibitors (Complete™ EDTA-free Protease Inhibitor Cocktail, Roche). Suspensions were flash frozen in droplets and cells subjected to cryogenic grinding using a Ball Mill MM 400 (5 cycles of 3 minutes at 20 Hz) ...
-
bioRxiv - Plant Biology 2021Quote: Frozen inflorescence tissue was ground with liquid nitrogen and resuspended in lysis buffer (50 mM Tris pH 8, 150 mM NaCl, 5 mM MgCl2, 10% glycerol, 1% IGEPAL, 0.5 mM DTT, 1 mM PMSF, 1X Roche protease inhibitor cocktail) and homogenized with mixing for 15 minutes at 4°C ...
-
bioRxiv - Plant Biology 2021Quote: Frozen inflorescence tissue was ground with liquid nitrogen and resuspended in lysis buffer (50 mM Tris pH 8, 150 mM NaCl, 5 mM MgCl2, 10% glycerol, 1% IGEPAL, 0.5 mM DTT, 1mM PMSF, 1X Roche protease inhibitor cocktail) and homogenized with mixing for 15 minutes at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... A master mix was made for each qRT-PCR target containing 5 ul of KAPA Universal SYBR Fast PCR mix (KAPA Biosystems, #KK4602), 0.6ul of 5 uM forward primer ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was diluted to a final concentration of 5 ng/μl and RT–qPCR was performed with KAPA SYBR® FAST qPCR kits (KAPA Biosystems) on a C1000 thermal cycler ...
-
bioRxiv - Neuroscience 2020Quote: ... Anti-sense riboprobes against target genes were synthesized from 5 µg linearized plasmids using digoxigenin-(DIG) or fluorescein-labeled uridylyltransferase (UTP) (#11685619910, #11277073910, Roche, Mannheim, Germany) and the MAXIscript in vitro Transcription Kit (#AM1312 ...
-
bioRxiv - Pathology 2021Quote: ... 2 x 106 insect cells from 48 post infection Hi5 cells incubated at 21°C were resuspended in lysis buffer (20 mM Na phosphate pH 7.5, 500 mM NaCl, 5% glycerol, Complete protease inhibitor, Roche Diagnostics, Rotkreuz, Switzerland) and sonicated until cells were > 99% lysed as determined by microscopic examination ...
-
bioRxiv - Physiology 2020Quote: ... Tissues were homogenised in assay buffer provided in the kit with the addition of 5 μL of protease inhibitor cocktail (Roche, Basel Switzerland) and centrifuged at 800 × g for 10 minutes at 4°C ...
-
bioRxiv - Genomics 2021Quote: ... 0.1% NP-40 and 5 mM β-mercaptoethanol) per gram of cells in the presence of protease inhibitors (Complete™ EDTA-free Protease Inhibitor Cocktail, Roche). Suspensions were flash frozen in droplets and cells subjected to cryogenic grinding using a Ball Mill MM 400 (5 cycles of 3 minutes at 20 Hz) ...
-
bioRxiv - Biochemistry 2021Quote: The pupae infected by the baculovirus were homogenized with a buffer solution (20 mM Tris-HCl, 150 mM NaCl, 5 mM DTT, 1mg/ml phenylthiourea, one inhibitor cocktail tablet (EASYpack, Roche, Basel, Switterland) per 50 ml solution ...
-
bioRxiv - Biochemistry 2021Quote: ... resuspended in lysis buffer (20 mM Tris pH 8.0, 150 mM NaCl, 5 mM imidazole, 0.4% Triton X-100, supplemented with Roche cOmplete Protease Inhibitor Cocktail) and lysed by sonication ...
-
bioRxiv - Biochemistry 2021Quote: ... resuspended in lysis buffer (20 mM HEPES pH 8.0, 150 mM NaCl, 5 mM imidazole, 0.1% Tween 20, supplemented with Roche cOmplete Protease Inhibitor Cocktail) and lysed by sonication ...
-
bioRxiv - Cancer Biology 2020Quote: ... to amplify the ligation product with 5 PCR cycles using 2x KAPA-HiFi HS Ready Mix and 10X KAPA primer mix (Roche Kapa Biosystems). The libraries were sequenced on HiSeq 4000 or NovaSeq 6000 (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: ... Femurs were then decalcified and paraffin sections (5-μm thickness) were stained with hematoxylin and eosin or reticulin (Reticulum II Staining Kit, Roche, Tucson, AZ) to assess fibrosis ...
-
bioRxiv - Immunology 2021Quote: ... it was added 50 µL of fresh TUNEL reaction mixture composed of 5 µL of enzyme solution mixed with 45 µL of labeling solution (In Situ Cell Death Detection kit, POD, ROCHE, version 15.0) for 1 hour at 37 °C ...
-
bioRxiv - Microbiology 2023Quote: ... Vero/TMPRSS2 cells (JCRB Cell Bank, Cat# JCRB1818) were cultured in DMEM containing 5% FBS and 1 mg/mL G418 (Roche, Basel, Switzerland). VeroE6/TMPRSS2 cells (JCRB Cell Bank ...
-
bioRxiv - Neuroscience 2023Quote: ... 10-15 fly heads were homogenised in guanidine extraction buffer (5M Guanidinium-HClSigma G3272, 50 mM Hepes Sigma H3375, 5 mM EDTA, protease inhibitor cocktail Roche Complete Mini). The plate was coated with first antibody solution (Clone 6E10 ...
-
bioRxiv - Developmental Biology 2023Quote: ... samples were brought to room temperature and washed twice in TNT before being incubated in blocking buffer (TNT+5% sheep serum+1% Roche blocking reagent) for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... Virus stocks were made using HEK-293/17 cells that were transfected with 5 μg of viral DNA using X-tremeGENE HP (Roche, Basel, Switzerland) after 48 h incubation ...