Labshake search
Citations for Roche :
251 - 300 of 7401 citations for 3 1 3 Dioxan 2 yl 3' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Washes were followed by blocking in 10% heat-inactivated sheep serum for 1-3 hours and incubation in buffer containing sheep antidigoxigenin antibody (Roche) at 1:5000 dilution for 16-20 hours at 4oC ...
-
bioRxiv - Biochemistry 2024Quote: ... Telomere ends were hybridized with Cy3-OO-(TTAGGG)3 in hybridization solution (70% formamide, 1 mg/ml blocking reagent (1109617601, Roche), and 10 mM Tris-HCl pH 7.2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Reverse transcription (RT) was performed from 2-3 µg of RNA with the Transcriptor First Strand cDNA Synthesis Kit (Roche Life Sciences, Basel, Switzerland) using random hexamer primers ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 % SDS and 5 mM EDTA) supplemented with 1x complete protease inhibitor cocktail (Roche, Switzerland) and 1 mM phenylmethylsulfonyl fluoride ...
-
bioRxiv - Neuroscience 2020Quote: ... which were stained with 5-bromo-4-cloro-3-indlyl phosphate/nitro blue tetrazolium (Roche) chromogenic substrates.
-
bioRxiv - Developmental Biology 2020Quote: ... in the presence of nitro blue tetrazolium/5-bromo-4-chloro-3′-indolyphosphate substrates (Roche). Stained embryos and gonads were embedded in gelatin ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were then pelleted and washed 3 times with PBS containing protease inhibitor (Roche, 11873580001). The pellets were snap-frozen and stored at -80°C for later use ...
-
bioRxiv - Neuroscience 2020Quote: ... MgCl2 50 mM] and incubated in 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Roche) and 4-nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Developmental Biology 2020Quote: ... and then incubated in nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate solution (Roche).
-
bioRxiv - Neuroscience 2020Quote: ... and nitro-blue tetrazolium chloride (NBT)/5-bromo-4-chloro-3′-indolyphosphate (BCIP) substrate (Roche) according to published protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by NBT/BCIP (nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate) reaction (Roche). After in situ hybridization ...
-
bioRxiv - Cell Biology 2020Quote: ... as well as AP substrate consisting of 5-bromo-3-chloro-indolyl phosphate (Roche Diagnostics) and 4-nitro blue tetrazolium chloride (Roche Diagnostics ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were lysed at 3 days in ice-cold RIPA buffer containing protease inhibitors (Roche) and protein concentration was determined by BCA Assay (Gibco BRL ...
-
bioRxiv - Cell Biology 2021Quote: ... in the presence of nitro blue tetrazolium/5-bromo-4-chloro-3′-indolyphosphate substrates (Roche). Stained testicular explants were embedded in gelatin ...
-
bioRxiv - Molecular Biology 2022Quote: To determine the repM transcription start site a 2nd Generation 5’/3’ RACE Kit (Roche) was used according to the manufacturer’s instructions with some modifications ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primer2: 5’-CAAGCAGAAGACGGCATACGA*G-3’) and 15µl 2x Kapa HiFi HotStart Ready Mix (Kapa Biosystems), amplification was performed for 45 s at 98°C ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were then prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... NBT/BCIP (4-nitro blue tetrazolium chloride/5-bromo-4-chloro-3-indolylphosphate, Roche, 11681451001) was added after thoroughly washing samples ...
-
bioRxiv - Genomics 2023Quote: ... For 3-color detection the following antibody dilutions were made: anti-digoxigenin (Roche, cat. 11333089001) 1:10 ...
-
bioRxiv - Physiology 2023Quote: ... 3 µL of Light Cycler 480 SYBR® Green I Master mix (Roche Diagnostics, Switzerland), 0.24 µL of each primer (10X ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.17 mg/mL 5-bromo-4-chloro-3-indolyl-phosphate (BCIP; Roche, Basel, Switzerland) at room temperature for 1 h (Brn3acKOAP/cKOAP mice ...
-
bioRxiv - Biophysics 2021Quote: ... transient transfection was performed with a total of 1 µg of plasmids (EGFRmCitrine, PTBmCherry and cCblBF P at ratio 4:3:4 by mass) using FUGENE6 (Roche Diagnostics) transfection reagent and Opti-MEM (Gibco - Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... The HEK 293T cells were mixed with 1 μg of mouse Ano9 cDNA (mAno9-pEGFP-N1) and 3 μl FuGene HD (Roche Diagnostics). The transfected cells were plated onto glass coverslips that were kept in a 35-mm round Petri dish ...
-
bioRxiv - Cancer Biology 2021Quote: ... and digested either for 1 hour at 37°C in a digestion mix of 3 mg/ml collagenase type A (Roche, 11088793001) and 25 μg/ml DNAse (Invitrogen ...
-
bioRxiv - Zoology 2023Quote: ... Single staining was performed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP; 1:50 dilution in alkaline buffer; Roche Diagnostics). The cells were then stained overnight at room temperature.
-
bioRxiv - Evolutionary Biology 2023Quote: ... Each eluate (3 µl) was subjected to PCR amplification in 50-μl reactions containing 1 KAPA HiFi HotStart Uracil+ReadyMix (Kapa Biosystems) and 0.3 μM Dual Index primers of NEBNext Multiplex Oligos for Illumina (NEB) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cryosections were then washed 3 times for 5 minutes in PBT before being incubated with 1:10 TUNEL enzyme buffer (Roche #12156792910) at 37°C in the dark for 2 hours ...
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Neuroscience 2020Quote: ... The colometric reaction was performed using mixture of 5-Bromo-4-chloro-3-indolyl phosphate (Roche) and Nitro blue tetrazolium chloride (Roche).
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Plant Biology 2021Quote: ... and BCIP (5-Bromo-4-chloro-3-indolyl phosphate)-NBT (nitro blue tetrazolium) chromogenic substrates (Roche). Images were captured by Apotome2 Zeiss microscope system.
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Immunology 2021Quote: ... washed in FACS buffer (4% FBS, 3 mM EDTA, and 40 μg/ml DNAse I (Roche)) and incubated with combinations of antibodies to CD45 (30-F11) ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated in digestion solution (3 mg/mL collagenase D [Roche] in DMEM/F-12 [Gibco]) for 45 min at 37 °C with intermittent vortex mixing to dislodge soft tissues ...
-
bioRxiv - Physiology 2024Quote: ... and visualized using 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium substrate (Roche Diagnostics). After color development for 15 min (gal) ...
-
bioRxiv - Immunology 2023Quote: ... ‘reverse’ 5’-GGGTACTTGATTTCATAGACTTTA-3’) were used in a qRT-PCR on a LightCycler 480 II (Roche). The data were analysed with LightCycler® 96 SW 1.1 (Roche) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were resuspended and washed twice in 3 ml Red Blood Cell Lysis Buffer (Roche) to remove any visible blood cells ...
-
bioRxiv - Neuroscience 2023Quote: ... and nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 5 hours ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl of 10% SDS and 5 μl of 10 mg/ml Proteinase K (Roche, #31158) were added and incubated at 50 °C for 1 h ...
-
bioRxiv - Immunology 2023Quote: ... prior to gene expression analysis by real-time quantitative PCR (LightCycler, Roche; or QuantStudio 3, ThermoFisher). Quantitect SYBR green PCR mastermix (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) substrate (Roche Diagnostics) for chromogenic detection ...
-
bioRxiv - Physiology 2024Quote: ... with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 1 hour (gal) ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification with 21 cycles was conducted by adding 3 µL KAPA HiFi HotStart ReadyMix (Roche) and 0.05 µL IS PCR primer (10 µM ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 µg gDNA of each population was amplified using the KAPA HiFi ReadyMix PCR Kit (Roche) with the TKO outer Fw and Rv primers (Primers are listed in Supplementary Table 4 ...