Labshake search
Citations for Roche :
201 - 250 of 7401 citations for 3 1 3 Dioxan 2 yl 3' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... The pellet was resuspended in Buffer 2 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5 % IGEPAL CA-630, 10 % glycerol, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 10 min followed by a centrifugation step ...
-
bioRxiv - Neuroscience 2020Quote: ... the pellet was washed 3 times with the buffer B and transferred in an enzyme solution (2 mg/mL Collagenase/Dispase (Roche, Bale, Switzerland), 0,147 µg/mL TLCK (Lonza ...
-
bioRxiv - Cell Biology 2021Quote: ... The membranes were blocked with 3% skim milk in TBS for 30 minutes and then probed with mouse anti-GFP (1:1,000, Roche) or rabbit anti-aldolase (Mesén-Ramírez et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... 100 mM KCl, 1 mM MgCl2, 0.5 mM β-mercaptoethanol, 0.1 mM GTP, 3 U/ml benzonase, 1X Roche Complete EDTA-free protease inhibitor ...
-
bioRxiv - Cell Biology 2022Quote: ... and 100 µL protein breakage buffer (50 mM Tris-HCl pH 8.0, 1 mM EDTA, 20 mM Tris pH 9.5, 3 mM DTT, 1X cOmplete EDTA-free inhibitor cocktail [Roche]) were added to the samples ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were first mechanically dissociated with a scalpel into approximately 1-3 mm pieces and enzymatically digested in RPMI-1640 medium (Cytiva) containing 0.25 mg/ml DNase I (Roche) and 0.25 mg/ml Collagenase (Sigma-Aldrich ...
-
bioRxiv - Physiology 2023Quote: ... or 50 Tris-HCl pH 7.5, 1 phenylmethylsulfonyl fluoride, 3% SDS (RyR, SERCA, CaMKIIδ-C273S) and supplemented with cOmplete protease inhibitor (Roche). Lysates were then incubated on ice for 15 min and centrifuged for 15 min at 15000 rcf at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 mM magnesium chloride) supplemented with 1 cOmplete protease inhibitor cocktail tablet per 50 ml of lysis buffer (Roche) and mechanically disrupted in a Dounce homogenizer ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected according to the manufacturer’s protocol at a µL lipofectamine: µg plasmid ratio of 3:1 (X-tremeGENE 9, Roche). After 48 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... pellets were resuspended in 100 μl of lysis buffer (50 mM Tris, pH 7.5, 1 mM EDTA, 3 mM DTT, and 1X cOmplete protease inhibitor cocktail [11836145001, Roche]) and lysed on a beadbeater for 5 min at room temperature with 100 μl of acid-washed glass beads ...
-
bioRxiv - Biochemistry 2024Quote: ... resuspended in lysis buffer (20 mM Tris-HCl, pH 7.5, 300 mM NaCl, 0.5 mM TCEP, 1× Benzonase, 3× protease inhibitor cocktail [Roche cOmplete]), and lysed using a cell disruptor at 1.5 kbar ...
-
bioRxiv - Cancer Biology 2020Quote: ... 80 µl of dephosphorylation solution (8 μl 10x dephosphorylation buffer, 2 μl RNasin Plus, 67 μl ddH2O, and 3 μl alkaline phosphatase (Roche, catalog no. 10713023001)) was added to the beads ...
-
bioRxiv - Neuroscience 2022Quote: ... 20 mg protein was loaded onto 8-10% SDS-PAGE gels for electrophoresis and subsequently transferred (90 V, 2-3 h) onto PVDF western blotting membranes (Roche, Cat. No. 3010040001) using the Criterion™ System BioRad ...
-
bioRxiv - Physiology 2020Quote: ... Sigma Aldrich) with 3% bovine serum albumin (BSA, 735078, Roche Diagnostics GmbH, Mannheim, Germany), 20 µg/ml gentamicin (G1397 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and measured each at least 3 times (technical replicates) in the LightCycler96 (Roche, Germany). We detected expression using SYBRgreen marker (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes were labelled with the DIG Oligonucleotide 3’-End Labelling Kit 2nd generation (Roche) with probe sequences listed in Table S1 ...
-
bioRxiv - Immunology 2022Quote: ... containing 3 mL of RPMI media with 70 μg / mL of Liberase TM (Roche) and 30 μg / mL of Dnase I (Roche) ...
-
bioRxiv - Biophysics 2020Quote: ... The oocytes were treated with collagenase A (3 mg/ml; Roche (Grenzach-Wyhlen, Germany)) for 105 min in Ca2+-free Barth’s solution containing (in mM ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was completed with 3% BSA protease free (Roche Ref# 03 117 332 001) for 1 hour at RT ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 400nM 5-Bromo-4-chloro-3-indolyl phosphate p-toluidine salt (BCIP, Roche).
-
bioRxiv - Microbiology 2024Quote: ... and specific primers (Table 3) on the LightCycler 480 Real-Time PCR System (Roche). Fold change was calculated using the comparative 2-ΔΔCt method ...
-
bioRxiv - Cell Biology 2023Quote: ... the cell samples were incubated with 300 nM DAPI (Cat# 28718-90-3, Roche) in PBS for 15 min and washed three times with PBS ...
-
bioRxiv - Physiology 2023Quote: ... and 0.165 mg/mL BCIP (5-Bromo-4-chloro-3-indolyl phosphate, Roche, 11383221001) in alkaline phosphatase buffer ...
-
bioRxiv - Genetics 2023Quote: ... Bound protein/protein complexes were washed 3 times ((1x TBS, 0.5% Nonident P40 (Roche), 1% phosphatase inhibitor cocktail 2 and 3 (Sigma)) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3’end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Developmental Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). 10 picomols of each probe were used for each slide ...
-
bioRxiv - Immunology 2023Quote: ... minced with razor blade and digested enzymatically with 3 mg/mL collagenase/dispase (Roche) at 37 °C for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Immunology 2024Quote: ... containing 3 mL of RPMI media with 70 µg / mL of Liberase TM (Roche) and 30 µg / mL of DNase I (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... containing 0.5% BSA and 3 mg/mL DNAse I grade II (Roche, Cat# 104159). Once resuspended ...
-
bioRxiv - Immunology 2024Quote: ... lungs harvested in HEPES buffer containing Liberase Blendzyme 3 (70 μg/mL; Roche, #05401020001) and DNaseI (30 μg/ml ...
-
bioRxiv - Physiology 2024Quote: ... and 5- nitro blue tetrazolium/bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) (Roche) as chromogenic substrates ...
-
bioRxiv - Molecular Biology 2020Quote: ... plasmid DNA from the in vitro methylation reactions were transfected with 3 µL (Il33) or 1 µL (SV40) X-tremeGENE 9 transfection reagent (Roche) diluted in 50 µL of Opti-MEM medium (Gibco) ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 mM sodium phosphate pH 8.0, 3% glycerol, 1% Triton X-100, 15 mM imidazole, and 1x protease inhibitor [Roche, Sigma]) and sonicated ...
-
bioRxiv - Neuroscience 2021Quote: ... and PI) and de-glycosylated for 3 h at 37 °C with 1 unit of PNGase-F (Roche Applied Science) added per 10 μl volume ...
-
bioRxiv - Cancer Biology 2020Quote: ... Exon 1 and exon 3 digestion products were purified using the High pure PCR product purification kit (Roche, Basel, Switzerland) according to the manufacturer’s protocol ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... ∼200-300 embryos were dechorionated 3-6 hours after injection by 5 min incubation in 1 mg/ml pronase (Roche) in E3 medium in a 2% agarose-coated petri dish and washed with excess amount of fresh E3 ...
-
bioRxiv - Bioengineering 2020Quote: ... Hela cells were plated one day before in 6-well plate at 50% confluency and transfected with 1 μg plasmid and 3 μl XtremeGeneHP transfection reagent (Roche) during 24 hours ...
-
bioRxiv - Immunology 2021Quote: ... and 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) (pH 8.0) and the presence of Complete® protease inhibitor (Roche). The preparation was centrifuged for 10 min at 2500 rpm and 4 °C and supernatant was transferred to a new tube and centrifuged for 40 min at 30,000 x g and 4 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... The lymphocytes from the immunized mice were fused with myeloma P3U1 cells at a ratio of 3:1 by mixing in 50% polyethylene glycol (Roche). The fused cells were dispersed in 80 ml of GIT medium (Wako ...
-
bioRxiv - Molecular Biology 2022Quote: ... blots were hybridized with 10 pmol/ml DIG-labeled (CAG)7 (5′-gcAgCagcAgca-3′) at 70°C for 4 h in hybridization buffer (5 × SSC, 1% block solution [Roche, Switzerland] ...
-
bioRxiv - Immunology 2023Quote: ... 1 mM EDTA) and then detected with 2,2’-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) diammonium (ABTS) substrate (Roche Diagnostics) diluted at 1:1000 in H2O2 ...
-
bioRxiv - Immunology 2023Quote: ... 1 mM EDTA) and then detected with 2,2’-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) diammonium (ABTS) substrate (Roche Diagnostics) diluted at 1:1000 in H2O2 ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were diluted 1:3 in ddH2O on ice in a 45 μL total volume before analysis in the Cobas c111 Analyzer (Roche). The Cobas c111 Analyzer is a platform for clinical chemistry testing of human samples but it can also be used to analyze mouse samples ...
-
bioRxiv - Bioengineering 2023Quote: ... SOS1•RAS complex was formed by incubating SOS1 and RAS at a stochiometric ratio of 1:3 overnight at 4° with 20 mM EDTA and alkaline phosphatase (Roche). The complex was then purified by gel filtration ...
-
bioRxiv - Immunology 2023Quote: ... the common bile duct was clamped and the pancreatic duct was perfused with 3-5 mL solution of collagenase P in HBSS-1% HEPES (Roche). The pancreas was then harvested and transferred to a 50mL conical tube containing 5mL of collagenase P solution and kept on ice until all organs were collected ...